Автомат точка: Запчасти для АКПП | Диагностика и ремонт коробки автомат

Содержание

Автомат Никонова — уникальное оружие превосходства: когда «Абакан» придет на смену «Калашникову»

Техническое наследие СССР


Испытания автомата Никонова завершились в 1991 году, практически одновременно с распадом СССР. В итоге плод многолетних научно-исследовательских и конструкторских работ оказался под обломками развалившегося государства. Спустя шесть лет его все же приняли на вооружение: ижевский завод выпустил несколько тысяч автоматов, после чего деньги на перевооружение армии закончились. АН-94 обрел статус «технического наследия СССР» и был почти забыт.


Сегодня оружие Никонова по-прежнему остается не у дел. И это при том, что именно оно победило в конкурсе «Абакан», подразумевавшем замену АК. Отчасти, это можно объяснить сложной судьбой «потерянного поколения»: в бардаке 90-х небольшая партия АН-94 была передана в войска без всяких объяснений. Что за оружие, в чем его преимущество? Иногда к нему даже не прилагались стандартные наставления, объясняющие устройство и назначения механизмов.

При этом мало кто знал, что еще в 80-х годах Главное ракетно-артиллерийское управление сочло автомат Никонова единственным образцом, чья сумма характеристик достаточна, чтобы начать тотальное перевооружение армии.

Война – не стрельбище


Отечественные наставления по стрелковому делу называет огонь очередями – основным видом стрелковой подготовки. Первым положением рычажка-переводчика у «Калашникова», после предохранительного, является «АВ» — автоогонь. И большинство стандартных армейских упражнений выполняется именно очередями, но почему, когда быстрее и проще выучится стрелять одиночным огнем.


Герои кинобоевиков палят очередями, чтобы буквально нашпиговать врага пулями. Понятно, что это всего лишь примитивный вымысел. В действительности, автоматический огонь требуется не для того, чтобы нанести противнику больший урон (поразив его несколько раз), а для того, чтобы вообще в него попасть.


Разумеется, что стрельбище или тир имеют мало общего с полем боя. Адреналин, дефицит времени на производство выстрела, неудобное положение, невозможность на глаз точно определить дистанцию, наконец, подвижность «мишеней» – и отличники стрелковой подготовки на поле боя легко превращаются в двоечников. Так каким образом компенсировать неизбежные ошибки прицеливания? Ответ прост, как ситец: нужно дать по противнику очередь – хоть одна пуля, да попадет. Эта нехитрая формула была выведена во время масштабных сражений Второй мировой войны


Человек – не пулеметный станок


Советское наставление 50-х годов предписывало солдату – если он засечет позицию снайпера, весь магазин нужно выпустить одной очередью. Однако сегодня такой совет выглядит наивным: опытный стрелок скажет, что подавляющее большинство пуль уйдут не в точку прицеливания.


Дело в том, что человек – не пулеметный станок, он восприимчив к отдаче. Каждый последующий выстрел в очереди все дальше уводит оружие с линии и все больше нарушает изготовку стрелка.

В этом смысле автоматы первого поколения себя не оправдали и распространенные западные образцы под «полновесный» винтовочной патрон 7,62 оказались бесполезны в режиме автоогня. АК и АКМ показали лучший результат, но все равно не удовлетворяли требованиям военных.


Стало ясно, что эффективность автоматического огня зависит от возможности оружия сделать серию выстрелов, пока ствол хотя бы приблизительно «смотрит» на цель. Только в этом случае пули будут рассеиваться вокруг мишени. Один из методов решения задачи – снижение уровня отдачи. Это было реализовано в автоматах второго поколения – АК-74 и М-16.

Второй способ – наращивание темпа стрельбы. Идеально, чтобы какое-то количество пуль успело покинуть ствол раньше, чем тело стрелка начнет воспринимать отдачу. Однако в классической схеме это нереализуемо: оружие должно обладать скорострельностью свыше 6 тысяч выстрелов в минуту.


Третье поколение


Работы над принципиально новым оружием третьего поколения с 70-х годов велись в СССР (программа «Абакан»), США и Германии. Конструкторы трех стран пытались достигнуть максимальной скорострельности при стрельбе короткой очередью. Но фактически только СССР, находившийся в то время на пике научно-технического развития, смог вытянуть третье поколение автоматов. Применив оригинальную лафетную компоновку, Геннадий Никонов создал оружие, производящее два выстрела за один полный цикл работы автоматики. Две пули покидают ствол быстрее, чем человек успевает ощутить отдачу.

Что это дает на практике? Две пули, выпущенные почти одновременно, из-за разброса ствола создают линию покрытия. Причем точно там, куда был нацелен автомат. У того же «Калашникова» вторая пуля из-за отдачи в очереди неизбежно уходит правее и выше точки прицеливания. Погрешность растет вместе с дистанцией: чем дальше цель, тем выше вероятность, что вторая пуля улетит «в молоко».


Таким образом, при стрельбе в сложных условиях, особенно по движущимся или появляющимся на короткий промежуток времени мишеням, «Никонов» демонстрирует тотальное преимущество над «Калашниковым». Согласно протоколу сравнительных испытаний автоматов, на 160 очередей у стрелков из АК приходится 48 попаданий. У стрелков, вооруженных АН-94 –106 попаданий в цель!


С момента принятия АН-94 на вооружение прошло двадцать лет, и, конечно, сегодня автомат уже нуждается в доработках. Однако предполагаемые затраты на модернизацию «Никонова» — ничто по сравнению с тем, сколько средств и труда было вложено в программу «Абакан» во времена СССР. И совершенно очевидно, что лучше заняться его модернизацией, нежели начинать разработку перспективного автомата с чистого листа.

 

Штатный автомат — Россия |

Interfax-Russia.ru — Минобороны и концерн «Калашников» подписали долгосрочный контракт на поставку автоматов АК-12, которые станут основным автоматом российской армии на ближайшие десятилетия.

Подписание долгосрочного контракта между министерством обороны РФ и концерном «Калашников» на поставку автоматов АК-12 состоялось в рамках военно-технического форума «Армия-2021», проходящего в подмосковной Кубинке.

Решение принять на вооружение новые автоматы концерна «Калашников» — АК-12 (калибр 5,45 мм) и АК-15 (7,62 мм) — в Минобороны приняли еще в 2018 году. АК-12 позиционируется как новый армейский автомат, АК-15 — как автомат для спецподразделений. Кроме того, АК-12 рассматривается как новая платформа, на базе которой планируется выпускать оружие разного калибра и назначения — как военного, так и гражданского.

В том же году концерн в рамках гособоронзаказа-2019 начал поставки автоматов в армию. Оружие было разработано по программе «Ратник» как элемент перспективного комплекса оснащения бойцов Вооруженных сил России с целью постепенной замены АК-74М.

В Минобороны тогда отмечали, что поставка первой партии серийных автоматов АК-12 в количестве 2 тыс. 500 единиц стала первой массовой закупкой новых автоматов за последние 30 лет. При этом, как уточнял журналистам замминистра обороны России Алексей Криворучко, программа перевооружения в дальнейшем предусматривает кратное увеличение объема поставки новых автоматов.

В 2019 году Минобороны РФ и концерн «Калашников» заключили трехлетний контракт на поставку порядка 150 тыс. АК-12 и АК-15. Предполагалось, что армия будет получать приблизительно по 50 тыс. автоматов в 2019, 2020 и 2021 году.

Теперь Минобороны РФ и «Калашников» подписали еще один долгосрочный контракт на поставку новых автоматов. Как сообщили «Интерфаксу» в пресс-службе концерна, в рамках этого контракта в течение ближайших лет будут поставлены «сотни тысяч наших автоматов».

«АК-12 — это автомат на следующие десятилетия, потому что он значительно превосходит АК-74 по эффективности применения и полностью соответствует всем требованиям, предъявляемым к современному стрелковому оружию», — добавили в пресс-службе.

Также в концерне сообщили об интересе к данному автомату и у других силовых ведомств России и стран СНГ. Сейчас МВД России и Росгвардия испытывают новый автомат АК-12. По результатам опытной эксплуатации ведомствами будет принято решение о возможности закупки.

Правда, раньше следующего года поставок в эти ведомства не ожидается.

В рамках форума «Армия-2021» «Калашников» также впервые продемонстрировал доработанный по требованиям Минобороны РФ автомат АК-12СП — одну из версий АК-12, в которой внедрен комплекс технических решений для повышения его эффективности, без вмешательства в узлы.

Так, по информации концерна, в рамках совершенствования эргономики оружия, на АК-12СП устанавливаются новый регулируемый приклад и пистолетная рукоятка, ранее представленные на модернизированном АК-12 на выставке «Армия-2020».

Приклад может дополнительно комплектоваться легкой складной щекой, позволяющей обеспечивать оптимальное положение головы стрелка при ведении огня с использованием оптических прицелов. Автомат имеет двухсторонний переводчик-предохранитель, конструкция которого позволяет одинаково удобно манипулировать им как правой, так и левой рукой.

Для обеспечения стабильности установки прицельных комплексов, АК-12СП оснащен новой алюминиевой ствольной накладкой с планкой Пикатинни и стандартными слотами типа M-Lok. Таким образом, обеспечена возможность установки на автомат различных комбинаций современных оптико-электронных приборов для эффективного применения оружия в любых условиях ведения боевых действий, в том числе ночью.

Между тем, по словам главы «Рособоронэкспорта» Александра Михеева, Россия ежегодно продает зарубежным странам более 100 тыс. автоматов Калашникова.

«Рособоронэкспорт уже подписал контракты и даже поставил ряду партнеров новые образцы этого легендарного автомата — АК «двухсотой» серии, а также АК-12 и АК-15″, — рассказал «Интерфаксу» глава компании.

О выходе на экспортный рынок новых автоматов АК-12 и АК-15 Михеев сообщил еще в феврале на выставке IDEX-2021 в Абу-Даби (ОАЭ). Тогда же Россия впервые представила за рубежом автомат АК-19, сконструированный под патрон стандарта НАТО (5,56х45мм).

Он уточнял, что объемы поставок за рубеж стрелкового оружия по линии Рособоронэкспорта держатся на постоянном стабильном уровне, и основную долю в этом сегменте занимает концерн «Калашников».

«Сегодня мы готовы предложить большое разнообразие моделей под любые потребности и возможности заказчика. Что касается легендарных автоматов Калашникова, то благодаря продолжению заложенных Михаилом Тимофеевичем Калашниковым традиций конструкторской работы в концерне линейка продукции постоянно расширяется и на образцы довольно оперативно оформляется разрешительная экспортная документация», — пояснял Михеев.

К тому времени партии новых автоматов АК-12 поступили в Армению и Казахстан, интерес к автомату проявила Белоруссия.

«В силу того, что в АК-12 используется патрон калибра 5,45, интерес к нему проявляют те страны ближнего зарубежья, где этот калибр стоит на вооружении. Небольшие партии были поставлены в Казахстан и Армению, сейчас интерес на приобретение небольшой партии для испытаний проявляет Белоруссия», — рассказывал на оборонной выставке Дмитрий Тарасов, занимавший тогда пост генерального директора концерна «Калашников».

По его словам, в концерне рассчитывают нарастить объемы поставок автоматов странам бывшего СССР.

«Там имеются запасы оружия, оставшиеся со времен Советского Союза, однако, со временем это оружие изнашивается, и у армий этих стран возникает необходимость перевооружения на более современные образцы», — уточнял Тарасов.

Кроме того, партия автоматов АК-15 для подразделений специального назначения была передана в середине августа Индии.

Также гендиректор «Рособоронэкспорта» сообщил «Интерфаксу» о подписании контракта с Индией на поставку 70 тыс. автоматов АК-103.

При этом Россия и Индия уже несколько лет ведут переговоры о создании совместного производства автоматов Калашникова. Индийское правительство еще в 2018 году заявило о намерении открыть производство автоматических штурмовых винтовок Калашникова для комплектации своей армии. До этого в стране был принят закон, позволяющий укомплектовывать вооруженные силы Индии автоматами АК-103.

В индийском городе Корва было открыто совместное российско-индийское предприятие «Индо-Рашн Райфлз Прайвет Лимитед» (Indo-Russian Rifles Private Limited) по производству автоматов Калашникова «двухсотой» серии. Газета The Economic Times ранее сообщала, что стоимость одного автомата АК-203, произведенного в Индии, составит около $960. При этом российская сторона в качестве отчислений будет получать с каждого произведенного автомата АК-203 примерно $85.

В начале февраля в «Рособоронэкспорте» отмечали, что контрактные документы, которые позволят Индии запустить лицензионное производство АК-203, уже проработаны. В самом же концерне заявили, что готовы приступить к реализации поставок и производства автоматов в Индии сразу после подписания соответствующего контракта.

«Как сторона переговоров, ответственная за техническую составляющую проекта, мы готовы будем приступить к его реализации и в поставочной части, и в части налаживания технологического процесса производства автоматов в Индии», — сообщили «Интерфаксу» в пресс-службе «Калашникова».

Что касается сроков подписания контракта и совместного предприятия по производству автоматов Калашникова, тот этот вопрос переадресовали в АО «Рособоронэкспорт» и ФСВТС России.

При этом в концерне уточнили, что с момента вступления контракта в силу потребуются «считанные месяцы» до начала производства.

Использование устройства «Торговый автомат» в творческом режиме Fortnite

На этой странице

Торговый автомат — это объект на карте, который может хранить и генерировать предметы с настраиваемыми параметрами стоимости. В торговом автомате может быть до трёх предметов, и игрок может переключаться между ними, ударяя по автомату киркой. Чтобы добавить в торговый автомат предметы, выбросите нужные предметы перед устройством в режиме редактирования.

Торговый автомат — одно из устройств творческого режима, позволяющих создавать предметы. В данном случае предметы появляются перед устройством после того, как игрок оплатит их стоимость. Предмет, который появляется в результате прямого взаимодействия игрока с устройством (а не с помощью дистанционной активации через приёмник), попадает в инвентарь игрока.

Состояние по умолчанию

При размещении торговый автомат неактивен. Если в режиме редактирования перетянуть на него предмет, этот предмет будет отображаться на экране. Когда игра начинается, игрок может взаимодействовать с устройством, в результате чего оно создаст предмет. По умолчанию цена предметов не установлена. В устройство можно в любой момент добавить до трёх предметов. При попытке добавить большее количество предметов торговый автомат покажет сообщение об ошибке.

Параметры

  • Тип ресурса для первого предмета: Определяет тип ресурсов для покупки первого предмета.

  • Стоимость первого предмета: Определяет сколько ресурсов (их вид определяется параметром Тип ресурса для первого предмета) нужно потратить на создание первого предмета.

  • Стоимость второго предмета в единицах камня: Если предметов несколько, второй предмет всегда будет продаваться за камень с указанной стоимостью.

  • Стоимость третьего предмета в единицах металла: Если предметов несколько, третий предмет всегда будет продаваться за металл с указанной стоимостью.

  • Дополнительные боеприпасы: Устанавливает количество дополнительных боеприпасов.

  • Включение в начале игры: Определяет, будет ли торговый автомат действовать в начале игры, или его необходимо сначала включить.

  • Время взаимодействия: Определяет, как долго игрок должен удерживать клавишу или кнопку взаимодействия, прежде чем появится нужный предмет.

Входящие сигналы

Следующие входящие сигналы приводят торговый автомат в действие.

Помещение предметов для добавления (в мире игры, в режиме редактирования)

Если в режиме редактирования поместить предмет перед торговым автоматом, устройство примет его и добавит в список продажи. Торговый автомат вмещает не больше трёх предметов, и предметы сверх этого лимита он принимать не будет.

Приёмники (входящие сообщения)

Приёмники ожидают сигнала по каналу и выполняют действие, получив отправленный по этому каналу сигнал от любого устройства (включая себя).

  • Включить при получении сигнала: Включает устройство при приёме сигнала по выбранному каналу. Если устройство не отключено, ничего не происходит.

  • Отключить при получении сигнала: Отключает устройство при приёме сигнала по выбранному каналу. Отключенный торговым автомат переходит в неактивное состояние, и игроки не смогут взаимодействовать с ним, чтобы переключить или купить предмет.

  • Создать предмет при получении сигнала: Торговый автомат создаёт предмет при получении сигнала по выбранному каналу.

  • Переключение на следующий предмет при получении: Переключает экран, демонстрируя следующий предмет, при приёме сигнала по выбранному каналу.

Исходящие сигналы

Создание предмета (в мире игры)

Основным результатом работы устройства является создание предметов. Созданный предмет появляется перед устройством. Предмет, который появляется в результате прямого взаимодействия игрока с устройством (а не с помощью дистанционной активации через приёмник), попадает в инвентарь игрока.

Передатчик (исходящие сообщения)

Передать сигнал при создании предмета: Передаёт сигнал по выбранному каналу, когда торговый автомат создаёт предмет.

Примеры использования торгового автомата во время игрового процесса

[Раскладка в лобби] Уже скоро!

5,45-мм автомат Калашникова АК-12. Проверка точности стрельбы и приведение автомата к нормальному бою. Извлечение из 6П70 РЭ.

 

Описание:
В настоящем материале представлены две главы из 5,45-мм автомат Калашникова АК-12. Руководство по эксплуатации. 6П70 РЭ. Нумерация абзацев оставлена согласно РЭ.

2.3 Подготовка автомата к стрельбе
2.3.1 Подготовка автомата к стрельбе проводится в целях обеспечения безотказной работы его во время стрельбы.
Для подготовки автомата к стрельбе необходимо осмотреть автомат в разобранном виде и смазать, осмотреть автомат в собранном виде, осмотреть магазин.
Непосредственно перед стрельбой прочистить насухо канал ствола (нарезную часть и патронник), осмотреть патроны и снарядить ими магазины.
Если автомат продолжительное время находился на морозе, перед его заряжанием несколько раз вручную энергично оттянуть назад и продвинуть вперед затворную раму.

2.4 Проверка точности стрельбы и приведение автомата к нормальному бою
2.4.1 Общие положения

2.4.1.1 Автомат, находящийся в подразделении, должен быть всегда приведен к нормальному бою.
Проверка точности стрельбы автомата, проводится при поступлении его в подразделение, после ремонта, замены частей, которые могли повлиять на точность стрельбы, при обнаружении во время стрельбы значительного отклонения пуль от цели.
В боевой обстановке должны быть использованы все возможности для периодической проверки точности стрельбы автомата и приведения его к нормальному бою.
Перед проверкой точности стрельбы автомат следует тщательно осмотреть и устранить обнаруженные неисправности.
Проверка точности стрельбы автомата и приведение его к нормальному бою производятся на стрельбище в безветренную погоду, в закрытом тире или на защищенном от ветра участке стрельбища при нормальном освещении.
Проверка точности стрельбы автомата и приведение его к нормальному бою проводятся стрельбой 5,45 мм патронами с обыкновенной пулей, индекс 7Н6. Стрельба производится на дистанцию 100 м, прицел автомата установлен на деление «1». Положение для стрельбы — лежа с упора.
Стрельба ведется по проверочной мишени (по черному прямоугольнику разме-рами: высота — 35 см и ширина — 25 см, изображенному на светлой бумаге размерами не менее 1 м — по высоте и 0,5 м — по ширине).

Мишень укреплена на вертикально расположенном щите. При стрельбе по проверочной мишени точкой прицеливания служит середина нижнего края черного прямоугольника, она должна находиться приблизительно на уровне глаз стреляющего. Точка прицеливания совпадает с контрольной точкой (далее — КТ), относительно которой ведется определение положения средней точки попада-ния (далее — СТП). Проверка точности стрельбы и приведение к нормальному бою автомата производятся одиночной стрельбой в четыре выстрела.

2.4.2 Проверка точности стрельбы
2.4.2.1 Для проверки точности одиночной стрельбы, стреляющий производит четыре выстрела, тщательно и однообразно прицеливаясь под середину нижнего края проверочной мишени (черного прямоугольника). По окончании стрельбы осматривается мишень и по расположению пробоин определяется кучность и точность стрельбы. Кучность стрельбы признается нормальной, если все четыре пробоины или три (при одной явно оторвавшейся) вмещаются в круг диаметром 15 см. Если расположение пробоин не удовлетворяет этому требованию, то стрельба повторяется. При повторном неудовлетворительном результате стрельбы автомат отправить в ремонт для устранения причин разброса пуль.

а, б — по четырем пробоинам; в — по трем пробоинам; г — определение оторвавшейся пробоины
Рисунок 26 — Определение средней точки попадания

 

Если кучность стрельбы автомата будет признана нормальной, то определяется точность стрельбы (СТП и ее положение относительно КТ). Для определения СТП по четырем пробоинам нужно в соответствии с рисунком 26а:
— соединить прямой линией две ближайшие пробоины и расстояние между ними разделить пополам;
— полученную точку соединить с третьей пробоиной и расстояние между ними разделить на три равные части;
— точку деления, ближайшую к двум первым пробоинам, соединить с четвертой пробоиной и расстояние между ними разделить на четыре равные части. Точка деления, ближайшая к первым трем пробоинам, и будет СТП четырех пробоин.
СТП можно определить также в соответствии с рисунком 26б следующим способом:  соединить пробоины попарно, затем соединить середины обеих прямых и полученную линию разделить пополам, точка деления и будет СТП.
Если все четыре пробоины не вмещаются в круг диаметром 15 см, то СТП  разрешается определять по трем более кучно расположенным пробои-нам при условии, что четвертая пробоина в соответствии с рисунком 26г удалена от СТП трех пробоин более 2,5 радиуса круга, вмещающего эти три пробоины.
Для определения СТП по трем пробоинам необходимо в соответствии с рисунком 26в:
— соединить прямой линией две ближайшие пробоины и расстояние между ними разделить пополам;
— полученную точку соединить с третьей пробоиной и расстояние между ними разделить на три равные части. Точка деления, ближайшая к первым трем пробоинам, и будет СТП.
При нормальной точности стрельбы автомата СТП  должна совпадать с  КТ  или отклоняться от нее в любом направлении не более чем на 5 см.
Автомат, точность одиночной стрельбы которого при проверке окажется ненормальной, приводится к нормальному бою согласно п. 2.4.3.

2.4.3. Приведение к нормальному бою
2.4.3.1 Если при стрельбе одиночными выстрелами СТП отклонилась от КТ в какую-либо сторону более чем на 5 см, то соответственно этому производится изменение положения мушки. Если СТП ниже КТ, мушку надо ввинтить, если выше — вывинтить. Если СТП левее КТ, целик прицела передвинуть влево, если правее — вправо.
При перемещении целика в сторону на 1 деление, СТП при стрельбе на 100 м из автомата смещается на 22 см.  Один полный оборот мушки, перемещает СТП по высоте при стрельбе на 100 м из автомата на 16,5 см.
Правильность перемещения мушки и целика проверяется повторной стрельбой.
2.4.4 Проверка точности стрельбы и приведение к нормальному бою на автомате с ПМС проводятся аналогично.

Источник:
6П70 РЭ из коллекции Павла Птицына
2020 г.


Прайс-лист на электромонтажные работы

Офисы обслуживания и терминалыОфисы и терминалы


‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60. 040389,30.393572], city: «Санкт-Петербург», adress: «Просвещения пр., д. 67», region: ‘Калининский’, subway: ‘Гражданский проспект’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [60.042447,30.389575], city: «Санкт-Петербург», adress: «Просвещения пр., д. 74, к. 2 («Перекресток»)», region: ‘Калининский’, subway: ‘Гражданский проспект’, line: ‘red-line’, items: [ { name: ‘Центр приема платежей’, hours: ‘09. 30 — 20.30, без выходных
‘ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [60.031445,30.43494], city: «Санкт-Петербург», adress: «Руставели ул., д. 61А («Лента»)», region: ‘Калининский’, subway: ‘Гражданский проспект’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.840709,30.243051], city: «Санкт-Петербург», adress: «Ветеранов пр., д. 50, к. 2», region: ‘Кировский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09. 00 — 20.00, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.830594,30.211268], city: «Санкт-Петербург», adress: «Ветеранов пр., д. 92», region: ‘Кировский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59. 854242,30.214817], city: «Санкт-Петербург», adress: «Ленинский пр., д. 94, к. 1, лит. А («Перекресток»)», region: ‘Красносельский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘09.00 — 20.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [59.852393,30.25357], city: «Санкт-Петербург», adress: «Ленинский пр., д. 118», region: ‘Кировский’, subway: ‘Ленинский проспект’, line: ‘red-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — сб: 09.15 — 20.15, перерыв: 13. 30 — 14.00, вс: выходной

‘, }, { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.856903,30.230861], city: «Санкт-Петербург», adress: «М. Жукова пр., д. 30А («Сезон»)», region: ‘Кировский’, subway: ‘Автово’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08.00 — 23.00, без выходных
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59. 858426,30.228498], city: «Санкт-Петербург», adress: «М. Жукова пр., д. 31, к. 1 («О’КЕЙ»)», region: ‘Красносельский’, subway: ‘Автово’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08.00 — 24.00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.871685,30.258708], city: «Санкт-Петербург», adress: «Стачек пр., д. 67, к. 2», region: ‘Кировский’, subway: ‘Автово’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09. 00 — 20.00, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.736911,30.571792], city: «Санкт-Петербург», adress: «Колпино, Трудящихся б-р, д. 12 (ТК «ОКА»)», region: ‘Колпинский’, subway: ‘Звёздная’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘09.00 — 23.00, без выходных
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.752643,30.575212], city: «Санкт-Петербург», adress: «Колпино, ул. Финляндская, д. 16-1, лит. А», region: ‘Колпинский’, subway: ‘Звёздная’, line: ‘blue-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — пт: 10.00 — 18.30, сб, вс: выходной
‘, }, { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, перерыв: 13.00 — 13.30,  вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.929849,30.433853], city: «Санкт-Петербург», adress: «Заневский пр., д. 65/1 («О’КЕЙ»)», region: ‘Красногвардейский’, subway: ‘Ладожская’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08. 00 — 24.00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.945779,30.489243], city: «Санкт-Петербург», adress: «Наставников пр., д. 24, к. 1 («Пятерочка»)», region: ‘Красногвардейский’, subway: ‘Ладожская’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08.00 — 23.00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘09.30 — 20.30, без выходных
‘ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59. 95689,30.47752], city: «Санкт-Петербург», adress: «Наставников пр., д. 46, к. 2», region: ‘Красногвардейский’, subway: ‘Ладожская’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.931017,30.409652], city: «Санкт-Петербург», adress: «Новочеркасский пр., д. 37, к.1», region: ‘Красногвардейский’, subway: ‘Новочеркасская’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — сб: 08. 45 — 19.45, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.989811,30.438508], city: «Санкт-Петербург», adress: «Пискаревский пр., д. 59 («Лента»)», region: ‘Красногвардейский’, subway: ‘Площадь Мужества’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно.’ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.949334,30. 465707], city: «Санкт-Петербург», adress: «Ударников пр., д. 19, к. 1», region: ‘Красногвардейский’, subway: ‘Ладожская’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.93481,30.496894], city: «Санкт-Петербург», adress: «Хасанская ул., д. 17, к. 1 («Лента»)», region: ‘Красногвардейский’, subway: ‘Проспект Большевиков’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59. 733083,30.085378], city: «Санкт-Петербург», adress: «Красное Село, пр. Ленина, д. 77А», region: ‘Красносельский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘09.00 — 19.00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, перерыв: 13.00 — 13.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.844082,30.178675], city: «Санкт-Петербург», adress: «П. Германа ул., д. 2 («О’КЕЙ»)», region: ‘Красносельский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08. 00 — 23.00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.851666,30.093589], city: «Санкт-Петербург», adress: «Петергофское ш., д. 98А («Лента»)», region: ‘Красносельский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.806374,30. 162314], city: «Санкт-Петербург», adress: «Таллинское ш., д. 159А («Лента»)», region: ‘Красносельский’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.997570948218,29.765941101852], city: «Санкт-Петербург», adress: «Кронштадт, пр. Ленина, д. 13, лит. А», region: ‘Кронштадтcкий’, subway: ‘Чёрная речка’, line: ‘blue-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — пт: 10.30 — 19.00, сб, вс: выходной
‘, }, { name: ‘Платежный терминал’, hours: ‘пн — сб: 09. 00 — 21.00, вс: 10.00 — 21.00
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.19725,29.705337], city: «Санкт-Петербург», adress: «Зеленогорск, пр. Ленина, д. 20а, лит. А», region: ‘Курортный’, subway: ‘Старая Деревня’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, перерыв: 13.00 — 13.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59. 864548,30.315554], city: «Санкт-Петербург», adress: «Бассейная ул., д. 27», region: ‘Московский’, subway: ‘Парк Победы’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09.45 — 20.45, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.45 — 20.45, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.851304,30.350139], city: «Санкт-Петербург», adress: «Космонавтов пр., д. 45, лит. А («О’КЕЙ»)», region: ‘Московский’, subway: ‘Московская’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08. 00 — 24.00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.832579,30.350741], city: «Санкт-Петербург», adress: «Ленсовета ул., д. 88», region: ‘Московский’, subway: ‘Звёздная’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59. 9302769656,30.3544434305], city: «Санкт-Петербург», adress: «Стремянная ул., д. 21/5, лит. А (вход с ул. Марата)», region: ‘Центральный’, subway: ‘Маяковская’, line: ‘green-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн -сб: 10.00 до 20.45, вс: выходной’, }, { name: ‘Платежный терминал’, hours: ‘10.00 — 21.00, без выходных’ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.833027,30.414054], city: «Санкт-Петербург», adress: «Бухарестская ул., д. 89, лит. А («Перекресток»)», region: ‘Фрунзенский’, subway: ‘Международная’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно‘ }, { name: ‘Центр приема платежей’, hours: ‘09. 30 — 20.30, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.985135166804,30.328152812978], city: «Санкт-Петербург», adress: «Белоостровская ул., д. 6, лит. А («ГУП ТЭК СПб»)», region: ‘Приморский’, subway: ‘Лесная’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — пт: 09.00 -18.00, сб, вс: выходной’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.808061,30.320692], city: «Санкт-Петербург», adress: «Шереметьевская ул., д. 11, лит. А», region: ‘Московский’, subway: ‘Московская’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: true, disable: true }, { center: [59. 853989,30.305996], city: «Санкт-Петербург», adress: «Новоизмайловский пр., д. 46, к. 1», region: ‘Московский’, subway: ‘Московская’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной

‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.859817,30.467715], city: «Санкт-Петербург», adress: «Бабушкина ул., д. 125 («Лента»)», region: ‘Невский (левый берег)’, subway: ‘Пролетарская’, line: ‘green-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘09. 30 — 20.30, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [59.895502,30.426738], city: «Санкт-Петербург», adress: «О. Берггольц ул., д. 11», region: ‘Невский (левый берег)’, subway: ‘Елизаровская’, line: ‘green-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.834564,30. 50482], city: «Санкт-Петербург», adress: «Прибрежная ул., д. 11», region: ‘Невский (левый берег)’, subway: ‘Рыбацкое’, line: ‘green-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09.15 — 20.15, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.909832,30.449535], city: «Санкт-Петербург», adress: «Дальневосточный пр., д. 16 («Лента»)», region: ‘Невский (правый берег)’, subway: ‘Улица Дыбенко’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59. 901008,30.46418], city: «Санкт-Петербург», adress: «Дыбенко ул., д. 13, к. 1», region: ‘Невский (правый берег)’, subway: ‘Улица Дыбенко’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.904207,30.476792], city: «Санкт-Петербург», adress: «Дыбенко ул., д. 25, к. 1», region: ‘Невский (правый берег)’, subway: ‘Улица Дыбенко’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09. 15 — 20.15, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.922995,30.481266], city: «Санкт-Петербург», adress: «Коллонтай ул., д. 28, к. 1», region: ‘Невский (правый берег)’, subway: ‘Проспект Большевиков’, line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59. 911823,30.469471], city: «Санкт-Петербург», adress: «Подвойского ул., д. 16, к. 1», region: ‘Невский (правый берег)’, subway: ‘Проспект Большевиков’, line: ‘orange-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — сб: 09.30 — 20.15, перерыв: 14.00 — 14.30, вс: выходной
‘, }, { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09.30 — 20.15, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.30 — 20.15, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.962633,30.291137], city: «Санкт-Петербург», adress: «Б. Зеленина ул., д. 17, лит. А», region: ‘Петроградский’, subway: ‘Чкаловская’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09.00 — 20.00, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.956665,30.301055], city: «Санкт-Петербург», adress: «Введенская ул., д. 5/13», region: ‘Петроградский’, subway: ‘Горьковская’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 08. 45 — 19.45, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: false }, { center: [59.967579,30.305385], city: «Санкт-Петербург», adress: «Ординарная ул., д. 19», region: ‘Петроградский’, subway: ‘Петроградская’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 08.45 — 19.45, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.869463,29. 828146], city: «Санкт-Петербург», adress: «Петергоф, Гостилицкое ш., д. 58, лит. А», region: ‘Петродворцовый’, subway: ‘Ленинский проспект’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.876436,29.918516], city: «Санкт-Петербург», adress: «Петергоф, ул. Константиновская, д. 8, лит. А», region: ‘Петродворцовый’, subway: ‘Ленинский проспект’, line: ‘red-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — пт: 10.00 — 18.30, сб, вс: выходной
‘, }, { name: ‘Платежный терминал’, hours: ‘пн — сб: 08. 00 — 20.00,  вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, перерыв: 13.00 — 13.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.86922,29.866632], city: «Санкт-Петербург», adress: «Петергоф, ул. Шахматова, д. 14, к. 1 («Дикси»)», region: ‘Петродворцовый’, subway: ‘Проспект Ветеранов’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘09.00 — 23.00, без выходных
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60. 000025,30.270485], city: «Санкт-Петербург», adress: «Богатырский пр., д. 13А («О’КЕЙ»)», region: ‘Приморский’, subway: ‘Комендантский проспект’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: true, disable: true }, { center: [60.003147,30.228246], city: «Санкт-Петербург», adress: «Богатырский пр., д. 42 («О’КЕЙ»)», region: ‘Приморский’, subway: ‘Комендантский проспект’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08.00 — 24. 00, без выходных
‘ }, { name: ‘Центр приема платежей’, hours: ‘10.00 — 21.00, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [60.022386,30.293428], city: «Санкт-Петербург», adress: «Вербная ул., д. 21, лит. А («Лента»)», region: ‘Приморский’, subway: ‘Удельная’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘09.30 – 20.30, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [60. 005392,30.282702], city: «Санкт-Петербург», adress: «Испытателей пр., д. 19, к. 2», region: ‘Приморский’, subway: ‘Пионерская’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [60.006587110358,30.262165912688], city: «Санкт-Петербург», adress: «Комендантский пр., д. 11», region: ‘Приморский’, subway: ‘Комендантский проспект’, line: ‘violet-line’, items: [ { name: ‘Клиентский зал’, hours: ‘ пн — сб: 09. 30 — 20.30, перерыв: 13.30 — 14.00, вс: выходной
‘, }, { name: ‘Платежный терминал’, hours: ‘пн- сб: 09.30 — 20.30, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн- сб: 09.30 — 20.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.03922,30.239538], city: «Санкт-Петербург», adress: «Парашютная ул., д. 60, лит. А («Лента»)», region: ‘Приморский’, subway: ‘Комендантский проспект’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘09. 30 — 20.30, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.998661,30.237355], city: «Санкт-Петербург», adress: «Планерная ул., д. 17, лит. А («Лента»)», region: ‘Приморский’, subway: ‘Комендантский проспект’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘09.30 — 20.30, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [59.984629,30.226046], city: «Санкт-Петербург», adress: «Савушкина ул. , д. 112, лит. А («Лента»)», region: ‘Приморский’, subway: ‘Старая Деревня’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.987048403196,30.226258296325], city: «Санкт-Петербург», adress: «Савушкина ул., д. 123, к. 1», region: ‘Приморский’, subway: ‘Старая Деревня’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.724138,30.411898], city: «Санкт-Петербург», adress: «Пушкин, Октябрьский б-р, д. 16, лит. А», region: ‘Пушкинский’, subway: ‘Купчино’, line: ‘blue-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — пт: 10.00 — 18.30, сб, вс: выходной
‘, }, { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, перерыв: 13.00 — 13.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.798656,30.399223], city: «Санкт-Петербург», adress: «Шушары, Московское ш., д. 16А («Лента»)», region: ‘Пушкинский’, subway: ‘Купчино’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.829023979965,30.377969354491], city: «Санкт-Петербург», adress: «Балканская пл., д. 5, лит. Я (ТК «Астра»)», region: ‘Фрунзенский’, subway: ‘Купчино’, line: ‘blue-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.869065,30.368563], city: «Санкт-Петербург», adress: «Будапештская ул., д. 11», region: ‘Фрунзенский’, subway: ‘Международная’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.00 — 20.00, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.849754,30.397974], city: «Санкт-Петербург», adress: «Бухарестская ул., д. 69, лит. А («Лента»)», region: ‘Фрунзенский’, subway: ‘Международная’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, { name: ‘Центр приема платежей’, hours: ‘09.30 — 20.30, без выходных’ } ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [59.857861,30.38979], city: «Санкт-Петербург», adress: «Славы пр., д. 43/49», region: ‘Фрунзенский’, subway: ‘Международная’, line: ‘violet-line’, items: [ { name: ‘Клиентский зал’, hours: ‘пн — сб: 09.15 — 20.15, обед: 14.00 — 14.30, вс: выходной

‘, }, { name: ‘Платежный терминал’, hours: ‘ пн — сб: 09.15 — 20.15, вс: выходной
‘ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.15 — 20.15, вс: выходной’ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.944143,30.361988], city: «Санкт-Петербург», adress: «Кирочная ул., д. 30», region: ‘Центральный’, subway: ‘Чернышевская’, line: ‘red-line’, items: [ { name: ‘Платежный терминал’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной’ }, { name: ‘Центр приема платежей’, hours: ‘пн — сб: 09.30 — 20.30, вс: выходной
‘ } ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: true, ear: true, stick: true, disable: true }, { center: [59.475839,33.85647], city: «Бокситогорск», adress: «Бокситогорск, ул. Красных Cледопытов, д. 4, лит. А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.474125,33.844325], city: «Бокситогорск», adress: «Бокситогорск, ул. Советская, д. 12″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.962709,34.027392], city: «Важины», adress: «Важины, ул. Школьная, д. 6″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.443304,29.479788], city: «Волосово», adress: «Волосово, пр. Вингиссара, д.17А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.450326,29.486669], city: «Волосово», adress: «Волосово, пр. Вингиссара, д. 89″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.898887,32.349322], city: «Волхов», adress: «Волхов, ул. Александра Лукьянова, д. 4, лит. А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.903828,32.355807], city: «Волхов», adress: «Волхов, ул. Волгоградская, д. 1, к. А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.019666,30.649502], city: «Всеволожск», adress: «Всеволожск, Октябрьский пр., д. 89 «, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.027782,30.619912], city: «Всеволожск», adress: «Всеволожск, ш. Дорога жизни, д. 12 («Лента»)», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: true, ear: true, stick: true, disable: true }, { center: [60.020876,30.644364], city: «Всеволожск», adress: «Всеволожск, ул. Заводская, д. 8″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.019666,30.649502], city: «Всеволожск», adress: «Всеволожск, Октябрьский пр., д. 89″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.711266,28.747248], city: «Выборг», adress: «Выборг, ул. Димитрова, д. 4″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.715703,28.74873], city: «Выборг», adress: «Выборг, ул. Железнодорожная, д. 2 «, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.714475,28.730521], city: «Выборг», adress: «Выборг, ул. Северный Вал, д. 3″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.408714,30.349375], city: «Вырица», adress: «Вырица, ул. Жертв Революции, д. 25″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.559398,30.127177], city: «Гатчина», adress: «Гатчина, ул. Карла Маркса, д. 18А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.548281,30.096778], city: «Гатчина», adress: «Гатчина, ул. Старая дорога, д. 2″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.558349,30.127887], city: «Гатчина», adress: «Гатчина, ул. Чкалова, д. 23″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.500474,34.657767], city: «Ефимовский», adress: «Ефимовский, 1 микрорайон, д. 11а», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.375702,28.221895], city: «Ивангород», adress: «Ивангород, Кингисеппское ш., д. 7А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.371805,28.607829], city: «Кингисепп», adress: «Кингисепп, ул. Воровского, д. 3″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.366569,28.618968], city: «Кингисепп», adress: «Кингисепп, ул. М. Гражданская, д. 4″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.44464,32.024985], city: «Кириши», adress: «Кириши, пр. Героев, д. 16″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.454337,32.023574], city: «Кириши», adress: «Кириши, ул. Комсомольская, д. 3 «, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.448739,32.016747], city: «Кириши», adress: «Кириши, пр. Ленина 26, лит. А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.884451,30.992776], city: «Кировск», adress: «Кировск, б-р Партизанской Славы, д. 5″, region: », subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.888749,30.999836], city: «Кировск», adress: «Кировск, ул Северная, д. 16″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.884266,30.989353], city: «Кировск», adress: «Кировск, ул. Энергетиков, д. 6″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.619989,30.390258], city: «Коммунар», adress: «Коммунар, ул. Гатчинская, д. 12″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.628316,30.400283], city: «Коммунар», adress: «Коммунар, ул. Ижорская, д. 24″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [61.125216,29.876888], city: «Кузнечное», adress: «Кузнечное, ул. Молодежная, д. 10, лит. А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘08.00 — 20.00, без выходных
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.735554,33.554744], city: «Лодейное Поле», adress: «Лодейное Поле, ул. Карла Маркса, д. 27″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru


‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.738554,33.538853], city: «Лодейное Поле», adress: «Лодейное Поле, ул. Ульяновская, д. 15, к. 1″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.915089,29.771327], city: «Ломоносов», adress: «Ломоносов, Дворцовый пр., д. 22а», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [58.738229,29.845187], city: «Луга», adress: «Луга, Железнодорожная ул., д. 2/6″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [58.736183,29.861689], city: «Луга», adress: «Луга, пр. Комсомольский, д. 16″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [58.738696,29.851942], city: «Луга», adress: «Луга, ул. Тоси Петровой, д. 12″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.064358,30.457973], city: «Мурино», adress: «Мурино, ул. Шоссе Лаврики, д. 85″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.914625,34.067251], city: «Никольский», adress: «Никольский, пр. Речного Флота, д. 19а», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.114531,32.322147], city: «Новая Ладога», adress: «Новая Ладога, ул. Луначарского, д. 2″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.774593,30.794338], city: «Отрадное», adress: «Отрадное, ул. Заводская, д. 11″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.769868,30.796341], city: «Отрадное», adress: «Отрадное, ул. Лесная, д. 1″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.515592,34.178085], city: «Пикалево», adress: «Пикалево, ул. Заводская, д. 11 А», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru

‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.916772,34.158259], city: «Подпорожье», adress: «Подпорожье, ул. Комсомольская, д. 1а», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru


‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [61.038907,30.147003], city: «Приозерск», adress: «Приозерск, ул. Калинина, д. 51″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.255908,29.61078], city: «Рощино», adress: «Рощино, ул. Советская, д. 57″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [61.106737,28.863382], city: «Светогорск», adress: «Светогорск, ул. Победы, д. 28″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.147804,30.215571], city: «Сертолово», adress: «Сертолово, Парковый проезд, д. 2, к. 1″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.146048,30.207962], city: «Сертолово», adress: «Сертолово, ул. Школьная, д. 2″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.086057,29.955841], city: «Санкт-Петербург», adress: «Сестрорецк, ул. Токарева, д. 1», region: ‘Курортный’, subway: ‘Старая Деревня’, line: ‘violet-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.121786,28.08342], city: «Сланцы», adress: «Сланцы, ул. Грибоедова, д. 1″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.116617,28.087705], city: «Сланцы», adress: «Сланцы, ул. Кирова, д. 39″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.117592,28.086555], city: «Сланцы», adress: «Сланцы, ул. Ленина, д. 10″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.531042,28.669687], city: «Советский», adress: «Советский, ул. Школьная, д. 27″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [60.558316,30.221985], city: «Сосново», adress: «Сосново, ул. Механизаторов, д. 11″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.902758,29.101876], city: «Сосновый Бор», adress: «Сосновый Бор, ул. Петра Великого, д. 9″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.730116,30.615187], city: «п. Тельмана», adress: «п. Тельмана, д. 2Б («Лента»)», region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘круглосуточно
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: true, allDay: true, eye: false, ear: false, stick: false, disable: false }, { center: [59.645078,33.563233], city: «Тихвин», adress: «Тихвин, 1а микрорайон, д. 37″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.644541,33.508274], city: «Тихвин», adress: «Тихвин, ул. Советская, д. 41″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.644859,33.545347], city: «Тихвин», adress: «Тихвин, 1 микрорайон., д. 2″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.540299,30.863813], city: «Тосно», adress: «Тосно, ш. Барыбина, д. 16″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе ООО «РКС-Энерго». Актуальный режим работы офиса на сайте rks-energo.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.547013,30.864595], city: «Тосно», adress: «Тосно, пр. Ленина, д. 19″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru’ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.537885,30.851758], city: «Тосно», adress: «Тосно, ул. Энергетиков, д. 7″, region: ‘Другой город’, subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘ Терминал установлен в клиентском офисе АО «ПСК». Актуальный режим работы офиса на сайте pesc.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, { center: [59.945752,31.034215], city: «Шлиссельбург», adress: «Шлиссельбург, ул. Жука, д. 3″, region: », subway: », line: ‘orange-line’, items: [ { name: ‘Платежный терминал’, hours: ‘Терминал установлен в клиентском офисе АО «ЕИРЦ ЛО». Актуальный режим работы офиса на сайте epd47.ru
‘ }, ], visaTerminal: false, visaCenter: false, allWeek: false, allDay: false, eye: false, ear: false, stick: false, disable: false }, ]

Фильтр

РайонВсе районыАдмиралтейскийВасилеостровскийВыборгскийКалининскийКировскийКолпинскийКрасногвардейскийКрасносельскийКронштадтcкийКурортныйМосковскийНевский (левый берег)Невский (правый берег)ПетроградскийПетродворцовыйПриморскийПушкинскийФрунзенскийЦентральныйСтанция метроВсе станцииАвтовоАкадемическаяБалтийскаяВасилеостровскаяГорьковскаяГражданский проспектЕлизаровскаяЗвёзднаяКомендантский проспектКупчиноЛадожскаяЛенинский проспектЛеснаяМаяковскаяМеждународнаяМосковскаяНарвскаяНовочеркасскаяПарк ПобедыПетроградскаяПионерскаяПлощадь ЛенинаПлощадь МужестваПриморскаяПролетарскаяПроспект БольшевиковПроспект ВетерановПроспект ПросвещенияРыбацкоеСенная площадьСтарая ДеревняТехнологический институтУдельнаяУлица ДыбенкоЧёрная речкаЧернышевскаяЧкаловскаяНаселенный пунктВсе населенные пунктыСанкт-ПетербургБокситогорскВажиныВолосовоВолховВсеволожскВыборгВырицаГатчинаЕфимовскийИвангородКингисеппКиришиКировскКоммунарКузнечноеЛодейное ПолеЛомоносовЛугаМуриноНикольскийНовая ЛадогаОтрадноеПикалевоПодпорожьеПриозерскРощиноСветогорскСертоловоСланцыСоветскийСосновоСосновый Борп. ТельманаТихвинТосноШлиссельбург

На карте

Списком

Конечные автоматы


Конечный автомат — абстрактная модель, типичный паттерн в разработке компиляторов и не только. Реализовать автомат можно в любом стиле программирования — процедурном, объектно-ориентированном или функциональном.

Что такое автомат?

Будучи абстрактной моделью, автомат в коде или в схемах может стать чем угодно. Ниже показан пример диаграммы состояний для автомата, моделирующего выключатель:

У этого автомата есть:

  • два состояния (“свет выключен”, “свет включён”)
  • два перехода между этими состояниями
  • одно событие “нажали кнопку”, которое вызывает оба перехода
  • псевдопереход от чёрного кружка с заливкой, показывающий, какое состояние будет начальным. Конечного состояния здесь нет (иначе оно было бы помечено псевдопереходом к чёрному кружку без заливки)

Чуть более сложный автомат для разбора числа с плавающей точкой показан ниже:

Оба этих автомата являются детерминированными, потому что входной символ или событие однозначно определяет переход, и нет “самопроизвольных” переходов при отсутствии события. Если эти условия не соблюдаются, автомат становится недетерминированным. Также автомат не является детерминированным, если он использует дополнительную память (например, стек ранее накопленных символов) для принятия решения о переходе.

Детерминированный и недетерминированный конечные автоматы

Детерминированный конечный автомат может разобрать строку в один проход из начала в конец, не используя дополнительной памяти кроме заранее заданных таблицы состояний и таблицы переходов между состояниями по событиям. В этой предсказуемости и линейной сложности разбора строки его главное преимущество. Например, в конце разбора строки автомат лексического анализатора приходит в состояние accepted либо в состояние error, что означает успешный или неуспешный разбор строки на токены соответственно.

Любой детерминированный конечный автомат имеет эквивалентное регулярное выражение, и эквивалетный язык регулярной грамматики, и наоборот. По сути это три разных формы представления одной сущности.

Существует формальный алгоритм превращения недетерминированного автомата без дополнительной памяти в детерминированный. Кстати, подобные алгоритмы используют реализации библиотек регулярных выражений: например, для выражения "([a-z])|([a-z]\(\))" легко составить недетерминированный автомат с неоднозначными или пустыми переходами, а алгоритм позволяет превратить его в детерминированный.

Регулярное выражение в ДКА

В промышленных библиотеках регулярных выражений многие операции избыточны и лишь для удобства. Если убрать лишнее и оставить минимум, достаточный для создания произвольных регулярных выражений, то останутся три операции:

  • Символ * задаёт итерацию (a.k.a. замыкание Клини)
    • Пример: “1*” ищет строки “”, “1”, “11”, …
  • Пустая строка задаёт конкатенацию двух выражений
    • Пример: “ab” ищет подстроку “ab”, “ab*” ищет подстроки вида “a”, “ab”, “abb”, …
  • Символ задаёт объединение
    • Пример: “a b c d” ищут подстроки “a”, “b”, “c”, “d”

Мы построим детерминированный конечный автомат на основе заданного регулярного выражения. Пусть дано выражение "xy* (x | y*) | ab (x | y*) | (x | a*) (x | y*)", построим для него диаграмму автомата. Для наглядности обозначение начальных и конечных состояний убрано — мы считаем, что любой неожиданный символ переводит в состояние ошибки.

Преобразуем конкатенацию с (x | y*):

Преобразуем объединение:

Преобразуем конкатенацию:

Получаем промежуточный εНКА, т.е. НКА с “пустыми” — или “самопроизвольными” — переходами:

Убираем переходы по пустой цепочке ε:

Теперь состояния s3 и s5 оказались эквивалентны. Уберём s5, переименуем s6->s5, s7->s6.

Убираем неопределённые переходы из НКА:

Теперь p1 и p5 эквивалентны. Уберём p5, переименуем p6->p5, p7->p6.

Полученный автомат эквивалентен выражению "xy* (x | y*) | ab (x | y*) | (x | a*) (x | y*)".

  • он допускает “aaax”
  • он не допускает “xyyb”

Применение конечных автоматов

Существует классификация программ по принципам их работы. Один из вариантов – это классификация Д. Харела, которая делит программы на три вида

  • Трансформирующие системы только трансформируют данные, то есть работают в пакетном режиме
  • Реактивные системы ещё и реагируют на команды или события
  • Интерактивные системы реагируют на команды или события и делают ответное воздействие

Автоматы применяют в трансформирующих системах, особенно связанных с обработкой текста. Примером подобной системы является интерпретатор, компилятор, шаблонизатор, или же любой простой скрипт для обработки запроса к серверу:


Ток Отключения и «Неотключения» Автоматического Выключателя

Понятие ток неотключения автоматического выключателя мало кому знакомо. Люди ошибочно полагают что, установив автомат на 16 Ампер он обязательно сработает при 16-ти Амперной нагрузке. На самом деле это не так.

Все это связано с ВТХ – время-токовыми характеристиками. В данной статье уважаемые читатели сайта «Электрик в доме» я постараюсь пояснить, почему так важно учитывать этот параметр при выборе автоматов.

Электрический ток протекает только по замкнутой цепи. Если её разорвать, действие тока будет прекращено. На этом свойстве строится защита электрических линий с помощью автоматических выключателей. При аварийном режиме в электрической цепи возникает ток срабатывания автомата, на который реагируют тепловой или электромагнитный расцепители, разрывая контролируемую цепь.

Для бесперебойного и надёжного питания потребителей, подбирают выключатели, длительно выдерживающие номинальный ток или ток отключения автомата.

Токи не отключения автомата могут привести к аварийной ситуации, например, к возгоранию электрической проводки в вашем доме. Поэтому, для безопасности, помимо правильного определения сечения кабеля, важен точный расчёт номинала автомата, выбор которого проводят, учитывая ток не отключения автоматического выключателя.

О чем говорят время-токовые характеристики

О работе автоматических выключателей судят по время-токовым характеристикам (ВТХ), определяющим точный период срабатывания защитного устройства. Наверняка, вы сталкивались с тем, что в маркировке автоматов участвуют буквенные обозначения: B, C, D.

Это ВТХ автоматических выключателей, ток мгновенного их срабатывания. Другими словами, это наименьший ток, при котором автоматический выключатель разорвет цепь без задержки времени (ГОСТ 50345-2010, п. 3.5.17). Так работает его электромагнитная защита (реагирующая на ток короткого замыкания).

Рассмотрим время-токовую характеристику С. На графике видно, как зависит от тока, проходящего через автомат, время его срабатывания. Вертикально расположенная ось У (ординат) показывает время (секунды).

 

Горизонтальная ось Х (абсцисс) – отражает отношение тока в цепи к номинальному току коммутационного аппарата (I/In). Простыми словами это параметр показывает загруженность (перегруз) автоматического выключателя.

График представлен в виде двух кривых, показывающих временной диапазон действия теплового и электромагнитного расцепителя автомата.

Расположенная сверху кривая определяет холодное состояние, когда автомат предварительно не включался. Кривая, расположенная ниже, характеризует горячее состояние, когда автомат уже был включен в сеть и (или) произошло его защитное срабатывание.

Ток условного «неотключения» автомата — 1,13•In

Ток не отключения автоматического выключателя. Что это такое и откуда он берётся? Рассмотрим ВТХ защитного устройства — автомата. На оси Х (абсцисс), отражающей кратность тока нагрузки в цепи к номинальному току (I/In), находим цифру — 1,13.

Из этой точки вверх проводим вертикальную линию. (На рисунке, расположенном ниже, линия выделена красным цветом.)

Ищем точки пересечения этой линии с кривой времени срабатывания автомата. Видим, что таких точек нет. Делаем вывод, что автомат не сработает, если в цепи будет ток, превышающий номинальный в 1,13 раз.

Автоматические выключатели, пропуская через себя ток, превышающий их номинальный в 1,13 раз, должны поддерживать работу цепи на протяжении целого часа (ГОСТ 50345). При невыполнении этого условия, устройства автоматической защиты бракуются.

Условный ток не расцепления любого автомата составляет 1,13•In. При такой токовой нагрузке устройство защиты не отключается:

  1. 1 час у автоматов с номиналом менее 63 А;
  2. 2 часа у автоматов с номиналом более 63 А.

На графиках времятоковых характеристик автоматических выключателей производителями отмечается точка условного не расцепления (1,13•In).

Если через эту точку провести вертикальную прямую, становится видно место её пересечения с нижней кривой на участке 60-120 минут. К примеру, при прохождении тока 1,13•In = 11,3 (А) через автомат, номинал которого составляет 10 А, его тепловой расцепитель не разомкнёт цепь на протяжении 1 часа.

Так же, при прохождении тока 1,13•In = 18,08 (А) через автомат номиналом 16 А в течение 1 часа не сработает его тепловой расцепитель.

Ниже приведены значения токов условного не расцепления для автоматических выключателей различного номинала:

Номинальный ток автомата (Ампер) Ток неотключения (перегруз 13 %)
6 6,78
10 11,3
16 18,08
20 22,6
25 28,25
32 36,16
40 45,2

В соответствии с времятоковыми характеристиками, автоматы не будут срабатывать при прохождении через них токов, указанных в правом столбце. Это особенно важно, если в вашей сети возможно подключение большой нагрузки, а электропроводка устарела, изоляция проводов нарушена, монтажные работы были проведены некачественно.

Тогда ток не отключения автомата возрастёт, а сечение отходящего кабеля может оказаться недостаточным для создавшейся нагрузки. Поэтому, старайтесь выбрать защитное оборудование и сечение проводников с оправданным запасом. Чтобы не заниматься каждый раз расчетами, обращайтесь к представленной ниже информации.

Ток условного расцепления (отключения) — 1,45•In

Какой же ток отключения автомата? Продолжим анализировать время-токовую характеристику. На горизонтальной оси, находим следующее за 1,13 значение. Это число 1,45. Из этой точки проводим вертикаль, видим её пересечение с графиком в 2 местах.

На кривой, расположенной ниже, место пересечения — 40 секунд. На кривой, расположенной сверху – 60-120 минут, в зависимости от номинала автомата. Для защитных устройств с номинальным током менее 63 А на отключение уйдёт не более 1 часа. А для устройств с номинальным током выше 63 А для этого потребуется 2 часа.

Автоматический выключатель номиналом 10 А способен, не срабатывая в продолжение 1 часа, выдерживать нагрузку 14,5 А. Автомат номиналом 16 А на протяжении этого же времени способен удерживать нагрузку 23,2 А. Это при условии холодного их состояния в начале работы. Если защитное устройство было горячим, на его отключение потребуется от 40 секунд до 1 часа.

Ниже приведены токи условного расцепления для автоматических выключателей разного номинала:

Номинальный ток автомата (Ампер) Ток отключения в течении 1 часа (перегруз 45 %)
6 8,7
10 14,5
16 23,2
20 29
25 36,25
32 46,4
40 58

О чём нельзя забывать при расчете сечения кабеля для электропроводки (смотри выше).

Представим, что в сети нашего дома необходимо защитить проводку сечением 2,5 кв. мм. Многие пользователи идут на поводу у неграмотных электриков и устанавливают для этого 25 А автомат (аргумент у них как правило один – «чтобы не выбивало»).

Если посмотреть по таблицам ГОСТ 31996—2012 допустимый ток для такого сечения кабеля с ПВХ изоляцией то он составляет 27 Ампер.

В случае увеличения нагрузки на 45 % (36.25А), автомат может не срабатывать в течение 1 часа. Всё это время по проводнику будет протекать ток, значительно превышающий длительно допустимый (25 А). Это может привести к нагреванию и разрушению изоляции провода, возникновению пожароопасной ситуации или к короткому замыканию.

Ситуация усугубляется тем, что недобросовестные производители в последнее время занижают сечение жил.

Вывод

Из представленного выше видно, как много нужно времени для того, чтобы сработал ток отключения автомата, даже если он будет намного больше номинального. При неправильном выборе сечения провода, его изоляция за это время может расплавиться.

Это приведёт к возникновению аварийной ситуации.

Я еще раз об этом напомнил, чтобы подчеркнуть насколько важно, при каком токе отключается автомат в вашем доме и правильно выбрать номинал этого защитного устройства. Не менее важно провести грамотный расчет сечения проводов (кабеля) и сделать выбор с достаточным запасом.

Хочу еще отметить низкое качество современной электротехнической продукции. Повсеместно продаются китайские изделия. Такой товар лучше не покупать. Приобретайте автоматические выключатели у добросовестных производителей.

Похожие материалы на сайте:

Понравилась статья — поделись с друзьями!

 

Удалить автоматическую корректировку баллов

Вы можете удалить автоматические условные корректировки баллов из параметров вопросов или заданий.

  1. Откройте окно условных баллов.
    Отсюда Сделать это

    Из настроек задания (редактор заданий, шаблоны заданий Управляющий)

    В разделе нажмите «Добавить» или редактировать.

    Из одного вопроса (редактор заданий)

    В столбце «Бонус» или «Штраф» щелкните добавить или отредактировать.

  2. Выполните одно из следующих действий, чтобы удалить настройки условной точки:
  3. Обновите задание или шаблон задания.
    Чтобы обновить это Сделайте это

    Один вопрос

    Щелкните Обновить вопрос.

    Все вопросы на данный момент по заданию

    Щелкните «Обновить все вопросы».

    Настройки присвоения

    В Редакторе назначений или Диспетчере шаблонов назначений щелкните Обновлять.

    Окно условных баллов закроется, и ваше назначение или шаблон назначения обновлено.Не забудьте сохранить изменения в редакторе заданий или в шаблонах заданий. Менеджер.

Алгоритм автоматической регистрации облака точек на основе гистограммы признаков локальной поверхности

Abstract

В этой статье мы представляем эффективный алгоритм для регистрации облака точек при низкой скорости перекрытия и высоком уровне шума. Предлагаемый метод регистрации в основном включает четыре части: петлевую воксельную фильтрацию, выбор ключевой точки на основе кривизны, надежный геометрический дескриптор и определение и оптимизацию соответствий на основе пространственного отношения ключевых точек.Петлевая воксельная фильтрация фильтрует облака точек с заданным разрешением. Мы предлагаем алгоритм выбора ключевой точки, который имеет лучшую антишумовую и быструю способность. Дескриптор объекта ключевых точек является в высшей степени эксклюзивным, который основан на геометрическом соотношении между точками соседства и центром тяжести окрестности. Соответствия в паре двух облаков точек определяются по совокупности характеристик ключевых точек. Наконец, для выравнивания двух облаков точек применяются разложение по сингулярным значениям и алгоритм ICP.Предлагаемый метод регистрации позволяет точно и быстро регистрировать облака точек разного разрешения в шумных ситуациях. Мы подтверждаем наше предложение, представляя количественное экспериментальное сравнение с современными методами. Результаты экспериментов показывают, что предложенный алгоритм регистрации облака точек имеет более высокую скорость вычислений, более высокую точность регистрации и лучшие характеристики защиты от шума.

Образец цитирования: Lu J, Wang Z, Hua B, Chen K (2020) Алгоритм автоматической регистрации облака точек на основе гистограммы признаков локальной поверхности.PLoS ONE 15 (9): e0238802. https://doi.org/10.1371/journal.pone.0238802

Редактор: Цичунь Чжан, Брэдфордский университет, ВЕЛИКОБРИТАНИЯ

Поступила: 26 декабря 2019 г .; Одобрена: 23 августа 2020 г .; Опубликовано: 11 сентября 2020 г.

Авторские права: © 2020 Lu et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные находятся в рукописи и ее файлах с вспомогательной информацией.

Финансирование: Это исследование было частично поддержано Фондом естественных наук провинции Хэйлунцзян в Китае в форме гранта, присужденного JL (№ F201123). Дополнительного внешнего финансирования для этого исследования получено не было. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

1. Введение

С развитием новых сенсорных технологий, таких как Kinect, 3D LiDAR [1, 2] и наземные лазерные сканеры (TLS), трехмерное облако точек становится более удобным для получения. И эти технологии широко используются в областях трехмерной реконструкции, археологии, анализа медицинских изображений и т. Д. Обработка облаков точек стала горячей точкой исследований.Чтобы восстановить полную 3D-модель, необходимо получить облако точек с разных точек обзора. Но каждое облако точек находится в разных системах координат. Следовательно, облака точек многовидового изображения в разных системах координат должны быть преобразованы в одну систему координат. Этот процесс называется регистрацией облака точек. Регистрация облака точек является ключевым этапом в обработке облаков точек и имеет огромное значение для компьютерного зрения, компьютерной графики, робототехники и так далее.

По начальным условиям и точности регистрацию облака точек можно разделить на грубую регистрацию и точную регистрацию.Грубая регистрация позволяет быстро оценить грубую матрицу преобразования без строгих требований к начальному пространственному положению облаков точек. Штрафная регистрация позволяет получить хороший результат регистрации. Ученые предлагают множество алгоритмов регистрации облака точек. Из этих алгоритмов алгоритм итеративной ближайшей точки (ICP) является важным методом регистрации для точной регистрации [3]. Алгоритм ICP, предложенный Besl et al. можно итеративно получить лучшую матрицу преобразования по соответствию.Однако алгоритм ICP также имеет некоторые недостатки, такие как высокие требования к начальным положениям облаков точек. Chen et al. представил новый подход, который работает с данными диапазона напрямую и выравнивает последовательные сканирования с достаточным количеством перекрывающейся области, чтобы получить точное преобразование между сканированиями [4].

Ji et al. предложил гибридный алгоритм, объединяющий алгоритм GA и алгоритм ICP [5]. В литературе [6] Zhu et al. развернул улучшенный алгоритм итеративной ближайшей точки (ICP), в котором был введен адаптивный порог для ускорения итеративной сходимости.Менг объединил kd-дерево и экстраполяцию для повышения скорости и точности алгоритма ICP [7]. Чтобы повысить точность регистрации облака точек и скорость сходимости регистрации, Liu et al. взяли пары точек с меньшими евклидовыми расстояниями в качестве точек, подлежащих регистрации, и разработали модель ошибки измерения глубины и весовую функцию [8]. Agamennoni et al. представили метод регистрации облака точек, основанный на распределении вероятностей, который является еще одним типом точной регистрации [9].

В общем, обычные методы грубой регистрации основаны на описании локальных геометрических элементов, которое включает извлечение геометрических элементов и определение соответствий. Многие подходы к извлечению характерной точки широко известны. Ли предложил улучшенный алгоритм Харриса, объединив дискретную кривизну и вектор нормали для извлечения признака [10]. Оператор SIFT может уменьшить влияние изменения масштаба на поиск ключевой точки, но его вычисление является сложным [11, 12].В статье [13] метод совмещения с информацией о цветовом моменте улучшает точность совмещения. В литературе [14] будущие точки получаются с помощью трехмерной разности гауссианов по геометрическим скалярным значениям точек, что обеспечивает получение характерных особенностей. Пракхья С.М. рассчитал HoNo (гистограмму нормальных ориентаций) в каждой точке и обнаружил ключевую точку, оценивая свойства как HoNo, так и матрицы ковариации окрестностей [15]. Алгоритм точечной гистограммы (PFH) и алгоритм быстрой точечной гистограммы (FPFH) являются популярными алгоритмами описания признаков [16–18], которые генерируют гистограмму признаков для каждой точки на основе информации об особенностях.Prakhya S.M et al. применил метод двоичного квантования к современному дескриптору трехмерного объекта [19], SHOT [20], и создал новый двоичный описатель трехмерного объекта, B-SHOT. Клеппе А.Л. ввел дескриптор ключевой точки, используя конформную геометрическую алгебру [21]. Вместо вычисления дескриптора признаков и сопоставления признаков, конгруэнтные наборы из 4 точек (4PCS) и 4PCS на основе семантических ключевых точек (SK-4PCS) определяют соответствующие базовые наборы из четырех точек, используя правило соотношений пересечений [22, 23] .Mellado et al. улучшил 4PCS и предложил SUPER 4PCS и ускорил процесс регистрации [24]. Еще одна идея грубой регистрации — алгоритм Sample Consensus. Например, Ye et al. использовал алгоритм случайного согласования выборки (RANSAC) для исключения ошибочных совпадений [25]. В литературе [26] на этапе грубой регистрации алгоритм случайного согласования выборки (RANSAC) используется для получения преобразования между двумя трехмерными облаками точек. Алгоритм преобразования нормального распределения (NDT) используется для решения задачи двумерной регистрации в статье [27].И Магнуссон применил его в трехмерном пространстве [28]. Алгоритм неразрушающего контроля использует метод статистической вероятности для определения соответствующих пар точек в соответствии с нормальным распределением. Hong et al. предложил представление вероятностного преобразования нормальных распределений (PNDT), которое улучшает точность регистрации облака точек за счет использования вероятностей точечных выборок [29]. Huan Lei et al. представляют надежный глобальный подход к регистрации облака точек по точкам с однородной выборкой, основанный на собственных значениях и нормах, вычисленных по нескольким шкалам [30].

В отличие от вышеупомянутых методов, в этой статье представлен алгоритм выбора ключевой точки, который имеет лучшую антишумовую и быструю способность. Дескриптор объекта ключевых точек является в высшей степени эксклюзивным, который основан на геометрическом соотношении между точками соседства и центром тяжести окрестности. Мы подтверждаем наше предложение, представляя количественное экспериментальное сравнение с современными методами. Результаты экспериментов показывают, что предложенный алгоритм регистрации облака точек имеет более высокую скорость вычислений, более высокую точность регистрации и лучшие характеристики защиты от шума.

Остальная часть статьи построена следующим образом. В разделе 2 мы подробно представляем принцип работы алгоритма. В разделе 3 эффективность алгоритма показана экспериментально. Раздел 4 завершает эту статью.

2. Регистрация облака точек на основе гистограммы признаков локальной поверхности

Процесс регистрации в нашем методе в основном включает петлевую воксельную фильтрацию, поиск ключевых точек, дескриптор признаков, регистрацию облака точек и другие части.Блок-схема процесса регистрации показана на рис. 1.

2.1. Петлевая фильтрация вокселей

Разрешение между разными облаками точек при использовании разного оборудования для сбора данных для разных объектов сильно различается, что приводит к тому, что несколько параметров следует устанавливать вручную во время процесса регистрации. Если в облаках точек будет слишком много точек, время регистрации значительно увеличится. Фильтрация облака точек может решить указанные выше проблемы. По сравнению с отфильтрованным облаком точек, исходное плотное облако точек использует больше точек для описания поверхности объекта.Как показано на рис. 2, для описания той же поверхности требуется 17 точек в исходном плотном облаке точек, а в отфильтрованной точке только 7 точек. Облако точек с чрезмерной фильтрацией не может правильно описать поверхность, как показано на рис. 2 (C).

Разрешение облака точек — это среднее значение расстояний между каждой точкой и ближайшей к ней точкой в ​​облаке точек. Разрешение описывает разреженность облаков точек. Чем выше разрешение, тем реже облако точек.Чтобы добиться быстрой автоматической регистрации, сначала необходимо рассчитать разрешение облака точек: (1) где p i — i-я точка в облаке точек, — ее ближайшая соседняя точка, а n — количество точек в облаке точек.

Для уменьшения размера облака точек будет использоваться фильтрация вокселей. Создается трехмерная сетка вокселей, в которой каждая точка представлена ​​центром тяжести сетки.В этой статье разработана автоматическая воксельная фильтрация облака точек.

Для повышения эффективности регистрации облака точек фильтруются с равномерным разрешением 1,0 мм. Применяется автоматическая петлевая фильтрация вокселей, которая вычисляет максимальные и минимальные значения осей x, y и z входного облака точек, устанавливает трехмерную ограничивающую рамку в соответствии с этими значениями и делит ограничивающую рамку на маленькие кубики с заданными значениями. размер вокселя и представляет все точки в маленьком кубе с центром тяжести маленького куба.Таким образом, несколько точек внутри вокселя представлены одной точкой, а облако точек уменьшается.

Алгоритм фильтрации в данной статье реализован следующим образом:

  1. Отфильтруйте исходное облако точек с помощью фильтрации вокселей и установите окончательный размер вокселя, s target , равным 1,0 мм.
  2. Вычислить разрешение отфильтрованного облака точек, с сейчас .
  3. Если 1,02 * с сейчас больше с цель , завершите процесс фильтрации, иначе снова выполните фильтрацию вокселей на отфильтрованном облаке точек и размер вокселя с цикл определяется: (2)
  4. Перейти к шагу 2.

Отфильтрованное облако точек после вышеуказанных шагов будет использоваться в качестве начального облака точек для регистрации в следующих разделах, а его разрешение представлено как s n , которое также будет использоваться в следующих разделах.

2.2. Поиск ключевых точек

После фильтрации облака точек точки по-прежнему являются избыточными для регистрации облаков точек. Большинство точек расположены в местах, где местные особенности не видны, например, в плоской местности.Для повышения скорости регистрации найдены ключевые точки для регистрации. Чтобы найти ключевые точки, классические алгоритмы, основанные на одной точке, чувствительны к шуму. Для усиления устойчивости к шуму предлагается алгоритм поиска ключевой точки, основанный на наибольшей средней кривизне предключевой точки в ее окрестности. Алгоритм, предложенный в этой статье, имеет лучшую производительность, чем алгоритм, который полагается только на значение кривизны одной точки. Алгоритм поиска ключевых точек представлен на рис.3.

Ключевые точки получаются на основе окрестности точки. Окрестность точки p i определяется как набор, который включает в себя все точки внутри сферы с центром p i и радиусом r , где r = 5 * s n . s n — текущее разрешение облака точек. Ковариационная матрица E с размерностью 3 * 3 и собственными значениями λ 1 , λ 2 , λ 3 на основе окрестности p i рассчитываются: (3) (4) где a ∈ (1, m ) — a -я точка в окрестности p i и m — количество точек в окрестности точки p i .является центроидом окрестности p i . λ j и ν j — собственное значение и собственный вектор ковариационной матрицы E соответственно. λ 1 — наименьшее собственное значение. Кривизну можно оценить по указанным выше собственным значениям. Кривизна c i точки p i получается по следующей формуле: (5)

Для ускорения поиска ключевых точек в качестве ключевых точек-кандидатов выбираются точки, кривизна которых превышает пороговое значение c th .Порог кривизны составляет c th = c max — ( c max c min ) c, где max и c min — максимальная и минимальная кривизна во всех точках облачности, соответственно. N-мерный вектор-столбец , , , устанавливается для хранения флагов, которые указывают, является ли каждая точка в облаке точек ключевой точкой-кандидатом.Где n — количество точек облака точек. Начальное значение до является вектором со всеми нулями, то есть до i = 0, i ∈ (1, n ). Это означает, что точка i не является предключевой. Если кривизна i-й точки больше, чем c th , pre i устанавливается на 1 и делает его предварительной ключевой точкой.

Мы используем символ ac i для обозначения среднего значения кривизны всех точек в окрестности точки i th .Радиус окрестности r . Если точка p i не является предключевой точкой, ее среднее значение кривизны устанавливается равным 0, ac i = 0. Если точка p i — предключевая точка, будет рассчитана средняя кривизна ее окрестности ac i : (6) где — кривизна точки, а м — количество соседних точек.Точка соседства обозначается.

В процессе определения того, имеет ли предключевая точка наибольшее среднее значение кривизны, флаг предключевой точки до i устанавливается в 0, когда его среднее значение кривизны ac i меньше, чем значение его окружающих точек. Это может уменьшить количество предварительных ключевых точек и ускорить вычисление среднего значения кривизны. Среднее значение кривизны предключевой точки будет сравниваться со значениями кривизны соседних точек.Если среднее значение кривизны предключевой точки больше, чем у всех ее соседних точек, флаг предключевой точки будет установлен на 1, а флаг предключевой точки ее соседних точек будет установлен на 0. После В описанной выше процедуре точки, для которых флаг предварительной ключевой точки по-прежнему равен 1, берутся в качестве конечных ключевых точек p k .

Антишумовой принцип алгоритма поиска ключевой точки показан на рис. 4, где c th = 0.02. Кривизна круговых точек меньше 0,02, что означает, что эти точки являются нормальными. Поскольку кривизна квадратных точек больше 0,02, они являются предварительными ключевыми точками. Кривизна точки треугольника ненормальная, это точка шума. Средняя кривизна окрестности шестиугольной точки максимальна в ее окрестности, которая является ключевой. Из-за аномальной кривизны точки шума, точка шума может быть ошибочно принята за ключевую точку только из-за ее кривизны.Выбор ключевой точки в соответствии со средним значением кривизны окрестности может улучшить антишумовые возможности алгоритма поиска ключевой точки. Хотя кривизна шумовой точки велика, среднее значение кривизны окрестности соседних точек увеличивается, красная шестиугольная точка по-прежнему может быть правильно выбрана в качестве ключевой точки.

2.3. Дескриптор функции

Классический дескриптор объекта зависит от отношения между ключевой точкой и ее соседними точками.Из-за ненормальной информации, такой как норма шумовой точки, когда шум ошибочно принимают за ключевую точку, дескрипторы признаков не могут правильно описать геометрические особенности ключевой точки на основе информации о ее соседях. По этой причине мы предлагаем дескриптор объекта, в котором гистограмма локальной поверхности вычисляется в соответствии с расстоянием между соседними точками и центром тяжести окрестности ключевой точки, а также нормалью к точкам в окрестности.

Радиус окрестности ключевой точки p k обозначается r .Центр тяжести окрестности показан на рис. 5. d a — это расстояние от точки соседства до центра тяжести. Ближайшее расстояние — d мин. , а самое дальнее — d макс . d max d min разделен на 10 частей.

Длина каждой части d res составляет: (7)

Для соседней точки в соответствии с расстоянием d a , ∈ (1, 10) вычисляется как: (8) где ⌈⌉ означает округление до целого числа.

c a ∈ (-1,1) — это косинус угла между нормалью соседней точки и линией от центра тяжести, как показано на рис. 6. Где шестиугольная точка p k является ключевым моментом. Значение косинуса c a в среднем делится на 12 частей.

Каждая часть c res рассчитывается как: (9)

Для соседней точки ее номер группы значений косинуса, ∈ (1,12), вычисляется как (10)

Дескриптор объекта вычисляется в соответствии с геометрическим соотношением между центром тяжести и соседними точками в окрестности ключевой точки.Таким образом, эффект, когда шум ошибочно выбран в качестве ключевой точки, может быть уменьшен.

Принцип защиты от шума дескрипторов функций показан на рисунках 7 и 8 соответственно. Где шестиугольная точка p k является истинной ключевой точкой, а квадратная точка — центром тяжести своего окружения. Треугольник — это точка шума, а точка в виде ромба — центр тяжести окрестности, когда точка шума по ошибке выбрана в качестве ключевой.Как видно из рисунков, когда точка шума ошибочно принимается за ключевую, различие между двумя центрами тяжести невелико. В то же время для соседней точки значения (), рассчитанные по неверному центру тяжести, также имеют небольшую разницу. Дескриптор объекта, основанный на точке шума, по-прежнему может правильно описывать окрестности.

Двумерный массив f 12 × 10 используется для хранения информации о соседстве ключевой точки с 12 × 10 нулями в качестве начальных значений.

Согласно значениям bin c и bin d соседней точки, значение в соответствующей позиции 2D-массива f 12 × 10 добавляется на единицу. Как показано на рис. 9, [ bin c , bin d ] соседней точки — это [2, 3]. Таким образом, значение в позиции [2, 3] дескриптора признака f 12 × 10 ключевой точки p k добавляется на единицу.

Чтобы нормализовать значение в каждой позиции двумерного массива f 12 × 10 , оно делится на количество точек окрестности. После прохождения всех точек в окрестности ключевой точки получается двумерный массив f 12 × 10 , который выравнивается до вектора-столбца f из 120 строк. Вектор-столбец f используется в качестве дескриптора признака для ключевой точки p k .

2.4. Регистрация облака точек

Соответствия определяются на основе евклидовых расстояний дескрипторов ключевых точек. Вектор признаков ключевой точки исходного облака точек представлен символом, а вектор признаков ключевой точки целевого облака точек: (11) (12)

Евклидово расстояние между векторами признаков и рассчитывается по формуле: (13)

Поскольку дескриптор признака уже нормализован, среднее значение каждого измерения 120-мерного дескриптора признака, f avg , составляет: (14)

Когда разница между дескрипторами ключевых точек исходного облака точек и целевого облака точек меньше 0.5 * f avg , среднеквадратичная ошибка mse удовлетворяет: (15)

Генерируется kd-дерево на основе дескрипторов ключевых точек в исходном облаке точек. Ближайшая ключевая точка в целевом облаке точек ищется в сгенерированном дереве kd. Если среднеквадратическая ошибка ключевой точки в целевом облаке точек меньше 0,002, соответствующая пара точек будет добавлена ​​к начальному набору соответствий O .

Поскольку дескриптор объекта описывает информацию о соседстве ключевой точки, если окрестности разных ключевых точек похожи, могут быть сгенерированы некоторые неправильные начальные соответствия.Чтобы удалить неправильные соответствия, в этой статье предлагается составная функция окрестности исходной пары точек совпадения.

Используя информацию о евклидовом расстоянии и дескрипторе объекта ближайшей ключевой точки в качестве объединенного объекта, неправильное отношение соответствия отбрасывается в соответствии с объединенными объектами. Ближайшая соседняя точка для ключевой точки в исходном облаке точек находится, как показано на рис. 10. Это расстояние между точкой и.Среднее значение дескрипторов точки и точки принимается как составной объект окрестности точки. Найден ближайший сосед для ключевых точек в целевом облаке точек. Расстояние между точками и. Среднее значение дескрипторов точки и точки принимается как составной объект окрестности точки. Если абсолютное значение разницы между и превышает разрешение облака точек источника более чем в 10 раз, соответствие будет отброшено.В противном случае, если евклидово расстояние между векторами и больше 0,002, соответствие отбрасывается. После вышеуказанных процедур получается окончательный набор соответствий. Как показано на рис. 10, сплошные линии представляют несовпадения, а пунктирные линии — правильные совпадения. Хотя среднеквадратическая ошибка дескрипторов признаков точек и мала, расстояние до ближайших точек и сильно различается. А соседство и составные черты совершенно разные. Неправильное соответствие может быть эффективно удалено путем сравнения ближайшего расстояния до начальной соответствующей пары точек с составным объектом окрестности.

Согласно окончательному набору соответствия, матрица вращения и вектор переноса между исходным облаком точек и целевым облаком точек вычисляются с использованием алгоритма SVD, и грубая регистрация завершается. Затем завершается точная регистрация с использованием алгоритма ICP.

3. Эксперимент

Начальные положения облаков точек показаны на рис. 11. cheff_source, dragon_source, armadillo_source, happy_source и boy_source — это облака точек источника, представленные зеленым цветом.Cheff_target, dragon_target, armadillo_target, happy_target и boy_target — это целевые облака точек, представленные синим цветом.

Плотные облака точек можно упростить до заданного разрешения с помощью алгоритма, предложенного в этой статье. В таблице 1 показаны разрешения облака точек во время петлевой фильтрации, где заданное разрешение составляет 1 мм. После нескольких циклов воксельной фильтрации облако точек может быть автоматически настроено на указанное разрешение. Таким образом, регистрация может работать с облаками точек, полученными разными сканерами с разного расстояния, автоматически, исключая параметры ручной регистрации при повороте, которые основаны на облаках точек с разными размерами.После фильтрации разрешение исходного облака точек практически такое же, как у целевого облака с ошибкой около 1,2%.

Распределения ключевых точек облака точек dragon_source при гауссовском шуме с дисперсией σ * s n показаны на рис. 12. Видно, что ключевые точки, полученные с помощью предложенного алгоритма на основе средней кривизны точек в его окрестности распределены более равномерно. Ключевые точки расположены на поверхности, кривизна которой сильно меняется.После добавления гауссовского шума ключевые точки находятся в одном и том же месте почти для разных значений σ , что означает, что полученные ключевые точки устойчивы к шуму.

Ошибка регистрации определяется как среднее расстояние между соответствующими парами точек в исходном облаке точек и целевом облаке точек после регистрации. Чем меньше ошибка регистрации, тем лучше результат регистрации. Таблица 2 показывает, что алгоритм регистрации, предложенный в этой статье, является быстрым и имеет высокую точность регистрации.Когда шум небольшой, точность регистрации этих алгоритмов регистрации аналогична. При увеличении шума алгоритм регистрации, предложенный в этой статье, более точен, чем PFH, FPFH и SHOT.

В таблице 3 показано время вычисления дескрипторов признаков для различных радиусов. По мере увеличения радиуса окрестности время вычисления PFH и FPFH растет быстрее, а время вычисления SHOT и алгоритма, предложенного в этой статье, растет медленнее.

Когда достигается такая же точность, алгоритм оптимизации соответствия, предложенный в этой статье, имеет более короткое время, чем RANSAC, как показано в таблице 4.

Дескрипторы двух правильных соответствующих точек, полученных с помощью PFH, FPFH, SHOT и нашего метода, примерно одинаковы. На рис. 13–17 показаны неправильные соответствующие точки и их дескрипторы признаков, полученные этими методами. Левая сторона — это исходное облако точек, правая сторона — это целевое облако точек, а большая точка — это соответствующая точка. Поскольку локальные особенности схожи, PFH, FPFH и SHOT не могут различать неправильные соответствующие точки, но дескриптор объекта, предложенный в этой статье, все же может различать тонкие различия.Дескриптор функции, предложенный в этой статье, имеет лучшую различимую способность с меньшим количеством измерений.

Как показано на рис. 18, существует много соответствий ошибок при первом сопоставлении. Используя наш метод для удаления соответствий ошибок, окончательные соответствия в основном верны.

Рис 18. Сравнение исходных соответствий и соответствий после устранения ошибок.

(a) Начальные соответствия между a_s и a_t; (b) Окончательные соответствия между a_s и a_t; (c) Начальные соответствия между d_s и d_t; (d) Окончательные соответствия между d_s и d_t.

https://doi.org/10.1371/journal.pone.0238802.g018

В таблице 5 представлены параметры и результаты регистрации, используемые алгоритмом, предложенным в этой статье. Процесс регистрации осуществляется автоматически без вмешательства человека.

В таблице 6 приведены результаты регистрации при ручной настройке параметров алгоритма. Алгоритм фильтрации — воксельная фильтрация. Размер вокселя определяется несколькими испытаниями. Алгоритм поиска ключевой точки основан на равномерной выборке.Интервал выборки в 20 раз превышает размер вокселя. Дескриптор функции SHOT принят. Соответствия неисправностей удаляются алгоритмом RANSAC. Наконец, выполняется регистрация штрафа ICP.

По сравнению с алгоритмом настройки параметров вручную, алгоритм фильтрации, описанный в этой статье, может автоматически настраивать параметры в соответствии с разрешением облака точек. Несмотря на просто увеличенное время, он подходит для регистрации без ручного вмешательства. На рис. 19 показаны результаты регистрации нашего алгоритма с высокой точностью регистрации.

На рис. 20 показаны шесть различных направлений сканирования для создания шести облаков точек cheff. Шесть облаков точек имеют разную частоту перекрытия. Частота перекрытия двух выровненных облаков точек рассчитывается следующим образом. Сначала найдите пары ближайших точек в двух выровненных облаках точек. Когда расстояние между двумя ближайшими точками меньше пятикратного разрешения облака точек, точки рассматриваются как точки перекрытия. Количество перекрывающихся точек делится на количество точек в облаке точек как коэффициент перекрытия.

Как показано в Таблице 7, Рис. 21 и 22, когда коэффициент перекрытия больше или равен 43,72%, наш алгоритм регистрации имеет лучшую точность. Когда коэффициент перекрытия меньше или равен 37,52%, наш алгоритм не регистрируется. Когда коэффициент перекрытия больше или равен 57,58%, алгоритм PFH может точно зарегистрировать. Когда коэффициент перекрытия меньше или равен 43,72%, алгоритм PFH не регистрируется. Благодаря небольшому количеству ключевых точек в нашем алгоритме регистрации, сложность сопоставления ключевых точек может быть уменьшена, а эффект регистрации может сохраняться для ситуации с низким уровнем перекрытия.

Рис 21. Результаты регистрации по предложенному алгоритму.

(a) c_s1 Результат регистрации; (b) Результат регистрации c_s2; (c) Результат регистрации c_s3; (d) Результат регистрации c_s4; (e) Результат регистрации c_s5.

https://doi.org/10.1371/journal.pone.0238802.g021

Рис. 22. Результаты регистрации с использованием алгоритма PFH.

(a) c_s1 Результат регистрации; (b) Результат регистрации c_s2; (c) Результат регистрации c_s3; (d) Результат регистрации c_s4; (e) Результат регистрации c_s5.

https://doi.org/10.1371/journal.pone.0238802.g022

4. Заключение

В этой статье параметры фильтра адаптивно поворачиваются в соответствии с разрешением облака точек. Предлагается алгоритм поиска ключевой точки, основанный на среднем значении кривизны окрестности предключевой точки. В нем не используются общие алгоритмы поиска ключевых точек, которые полагаются на значения кривизны одной точки и повышают устойчивость к шуму, уменьшая повторяемость ключевых точек в одном и том же локальном регионе.В этой статье мы предложили метод вычисления дескриптора объекта на основе расстояний и нормального отношения между центром тяжести и каждой точкой в ​​его окрестности. Повышена устойчивость к шуму и уникальность дескриптора. Неправильные соответствия эффективно удаляются на основе объединенного признака соседства исходной пары совпадающих точек. Это обеспечивает точность регистрации и сокращает время проведения ВЧД. Предлагаемый алгоритм регистрации обладает хорошей точностью, вычислительной эффективностью и устойчивостью к шумам.Он подходит для автоматической регистрации облаков точек с низкой частотой перекрытия и большим шумом.

Ссылки

  1. 1. Хань М., Чжоу Б., Цянь К. 3D-локализация и отображение мобильных роботов на открытом воздухе с помощью LIDAR. Журнал Хуачжунского технологического университета. 2015.
  2. 2. Гезеро Л., Антунес К. Эффективный метод создания цифровых моделей местности из облаков точек, собранных с помощью мобильных лидарных систем. ISPRS Int. 2017.
  3. 3.Бесл П.Дж., Маккей Х.Д. Метод регистрации трехмерных фигур. IEEE Trans. Pattern Anal. Мах. Intell, 1992.
  4. 4. Чен Й, Жерар Медиони. Моделирование объектов путем регистрации разнородных изображений. Вычисления изображений и зрения. 1992; 10 (3): 145–155.
  5. 5. Ji S, Ren Y, Ji Z. Улучшенный метод регистрации облака точек. Optik — Международный журнал световой и электронной оптики. 2017; S0030402617300517.
  6. 6. Zhu QY, Wu JJ.Регистрация облаков точек LIDAR для обнаружения и реконструкции неструктурированной местности. ПРИКЛАДНЫЕ НАУКИ-БАЗЕЛЬ. 2018;
  7. 7. Мэн Дж. Г., Ли Дж. Л.. Ускоренный алгоритм регистрации ICP для данных трехмерного облака точек. 9-й Международный симпозиум по передовым технологиям производства и тестирования оптики (AOMATT) — оптические испытания, измерительные технологии и оборудование. Чэнду, PEOPLES R CHINA, 26–29 июня 2018 г., 10.1117 / 12.2504772.
  8. 8. Лю С., Гао Д., Ван П, Го Х, Сюй Дж., Лю Д.-Х.Регистрация взвешенного облака точек на основе глубины для внутренней сцены. Датчики. 2018; 18, 3608.
  9. 9. Agamennoni G, Fontana S, Siegwart, R.Y., Sorrenti, D.G. Регистрация облаков точек с вероятностной ассоциацией данных. В материалах Международной конференции IEEE / RSJ по интеллектуальным роботам и системам 2016 г. 2016; 4092–4098.
  10. 10. Li Q, Huang X. Извлечение признаков из облаков точек для проверки жестких деталей самолета с использованием улучшенного алгоритма Харриса.Измерительная наука и технология. 2018;
  11. 11. Лоу Д.Г. Отличительные особенности изображения от масштабно-инвариантных ключевых точек. Международный журнал компьютерного зрения. 2004; 60 (2): 91–110.
  12. 12. Xian Y, Xiao J, Wang Y. Алгоритм быстрой регистрации облака точек горных пород, основанный на сферической проекции и извлечении признаков. Границы компьютерных наук. 2019; 13 (1).
  13. 13. Chen WL, Yang Y. Регистрация цветового облака точек путем комбинирования с информацией о цветовых моментах.Международная конференция IEEE по системам, человеку и кибернетике (SMC), IEEE Syst Man & Cybernet Soc, Миядзаки, ЯПОНИЯ, 07–10 октября 2018 г .; 2102–2108.
  14. 14. Буэно М., Гонсалес-Хорхе Х., Мартинес-Санчес Дж. Автоматическая грубая регистрация облака точек с использованием геометрических дескрипторов ключевых точек для сцен внутри помещений. Автоматизация в строительстве. 2017; 81 (сеп.): 134–148.
  15. 15. Пракхья С. М., Лю Б., Лин В. Обнаружение наборов ключевых точек на трехмерных облаках точек с помощью гистограммы нормальных ориентаций.Письма о распознавании образов. 2016; 83: 42–48.
  16. 16. Амберг Б., Ромдани С., Веттер Т. Оптимальные ступенчатые нежесткие алгоритмы ICP для регистрации поверхности. Компьютерное зрение и распознавание образов. Конференция компьютерного общества IEEE. 2007: 1–8.
  17. 17. Р. Б. Русу, Н. Блодов, М. Битц. Гистограммы быстрых точечных объектов (FPFH) для 3D-регистрации. Международная конференция по робототехнике и автоматизации (ICRA). 2009; 12–17.
  18. 18. Wang X, Zhang X. Регистрация жесткого трехмерного облака точек на основе гистограмм точечных объектов.2-я Международная конференция по машинному оборудованию, электронике и моделированию управления (MECS). Тайюань, НАРОДЫ В КИТАЕ, 24–25 ИЮНЯ. 2017; 138: 543–550.
  19. 19. Пракхья С. М., Лю Б., Линь В. B-SHOT: двоичный трехмерный дескриптор объекта для быстрого сопоставления ключевых точек в трехмерных облаках точек. Автономные роботы. 2016.
  20. 20. Салти С., Томбари Ф., Ди Стефано Л. СНИМОК: уникальные сигнатуры гистограмм для описания поверхности и текстуры. Компьютерное зрение и понимание изображений. 2014; 125, стр.251–264.
  21. 21. Клеппе А. Л., Эгеланд О. Дескриптор на основе кривизны для выравнивания облака точек с использованием конформной геометрической алгебры. Успехи в прикладных алгебрах Клиффорда. 2018; 28 (2): 50.
  22. 22. Айгер Д., Митра Н. Дж., Коэн-Ор Д. 4-точечные конгруэнтные множества для надежной попарной регистрации поверхностей. ACM Press, документы ACM SIGGRAPH, 2008 г. — Лос-Анджелес. 2008.
  23. 23. Ge X. Автоматическая безмаркерная регистрация облаков точек с помощью семантически-ключевых точек конгруэнтных наборов ISPRS.Фотограмма. 2017; 130. С. 344–357.
  24. 24. Мелладо Н., Айгер Д., Митра Н. Дж. Быстрая регистрация глобального облака точек Super 4PCS с помощью интеллектуальной индексации. Форум компьютерной графики. 2014; 33 (5): 205–215.
  25. 25. Цинь Е, Ханг Лю, Юхан Линь. Изучение метода регистрации облака точек RGB-D на основе информации о цвете. Десятая международная конференция по информационной оптике и фотонике. 2018.
  26. 26. Чанг WC, Andini DP, Pham VT. Реализация обучения с подкреплением при планировании пути сборки на основе трехмерных облаков точек.Международная конференция по автоматическому управлению (CACS). 2018; 04–07.
  27. 27. П. Бибер, В. Штрассер. Преобразование нормальных распределений: новый подход к согласованию лазерного сканирования. Интеллектуальные роботы и системы, IEEE, стр. 2003; 2743–2748.
  28. 28. М. Магнуссон. Преобразование трехмерных нормальных распределений — эффективное представление для регистрации, анализа поверхности и обнаружения петель. Кандидат наук. докторскую диссертацию, Университет Эребру. 2009.
  29. 29. Хюнки Хонг, Б.Х. Ли. Вероятностные нормальные распределения преобразуют представление для точной регистрации трехмерного облака точек. Международная конференция по интеллектуальным роботам и системам (IROS), сентябрь 2017 г .; 24–28.
  30. 30. Лей Х., Цзян Г., Цюань Л. Быстрое распространение дескрипторов и корреспонденции для надежной регистрации глобального облака точек. Транзакции IEEE по обработке изображений: публикация Общества обработки сигналов IEEE. 2017; 26 (8): 3614.

границ | Производство CAR Т-клеток в медицинских учреждениях (ARI-0001) с использованием закрытого полуавтоматического биореактора: опыт клинического исследования фазы I академического уровня

Введение

Адоптивная иммунотерапия с переносом Т-клеток (ACT) — это область, которая постоянно расширяется, особенно в течение последних трех десятилетий.ACT включает распространение ex vivo опухолеспецифических клеток и реинфузию пациенту. Среди этих методов лечения использование Т-клеток химерного антигенного рецептора (CAR) для лечения нескольких гематологических злокачественных новообразований показало беспрецедентную эффективность. Следовательно, разработка этих методов лечения от кабинета до постели пациента была осуществлена ​​в впечатляюще короткие сроки (1–3).

CAR Т-клетки — это генетически модифицированные клетки, цитотоксическая активность которых была перенаправлена ​​на раковые клетки с целью устранения опухоли.CAR представляют собой химерные белки, состоящие из внеклеточной области, ответственной за связывание с определенным антигеном, и внутриклеточной области, которая способствует цитотоксической активности и пролиферации Т-клеток. Связывание CAR с выбранным антигеном обычно опосредуется одноцепочечным вариабельным фрагментом (scFv) моноклонального антитела. Область, полученная из scFv, приводит к MHC-независимому взаимодействию CAR с его лигандом. Этот scFv сочетается с одним или несколькими внутриклеточными костимулирующими доменами (обычно CD28 или 4-1BB) и проактиваторным цитотоксическим доменом (CD3ζ) (4-6).

Первые большие успехи в области CAR Т-клеток были достигнуты в исследованиях с использованием CAR 2-го поколения (включая костимулирующий домен), нацеленного на маркер линии CD19 пан-B-клеток. В этом исследовании Национального института рака и Университета Пенсильвании у одного пациента с фолликулярной лимфомой наблюдалась частичная ремиссия (7), а у двух из трех пациентов с прогрессирующим рефрактерным хроническим лимфоцитарным лейкозом (ХЛЛ) были получены полные ответы (8). Впоследствии эти и несколько других учреждений, включая онкологический центр Мемориала Слоуна-Кеттеринга и Онкологический исследовательский центр Фреда Хатчинсона, первыми провели несколько исследований с использованием немного разных конструкций CAR19 и подтвердили процент ответа от 50 до 80% при ХЛЛ, неходжкинской лимфоме (НХЛ) и острой лимфоме. лимфобластный лейкоз (ОЛЛ) (9–14).

В настоящее время прилагаются большие усилия для разработки новых CAR для других типов опухолей. Анти-BCMA CAR также продемонстрировал впечатляющую частоту ответа (около 90%) при множественной миеломе (ММ) (15-17). Кроме того, в настоящее время исследуются другие антигены, такие как CD30 и CD22, для лечения гематологических злокачественных новообразований (18–20). В области солидных опухолей терапия CAR Т-клетками пока что оказалась более сложной задачей. Первоначальные клинические испытания солидных опухолей показали ограниченную эффективность и высокую токсичность (21–30).Этот факт можно объяснить несколькими факторами: трудностью нахождения опухолеспецифических антигенов для мишени, плохой инфильтрацией Т-клеток в опухоль и иммуносупрессивным микроокружением опухоли, среди прочего. В настоящее время научное сообщество работает над поиском путей решения этих проблем (31, 32). В результате продолжаются десятки клинических испытаний с использованием CAR 4-го поколения (Armored CAR, CAR T-клетки, содержащие суицидные гены и CART, продуцирующие антитела) для лечения солидных опухолей (33–36).

Различные клинические применения и количество пациентов, ожидающих лечения, экспоненциально растут.Соответственно, количество учреждений и центров, которые нуждаются в возможности проводить терапию CAR Т-клетками, также растет. В этом контексте разработка систем, которые могут способствовать производству CAR-Т-клеток, имеет решающее значение для ускорения развития поля CAR-T-клеток, тем самым находя эффективные методы лечения всех видов злокачественных новообразований и других заболеваний.

С этой целью мы ранее сообщали о разработке и доклинической оценке нового анти-CD19 CAR на основе антитела A3B1 (37).Одновременно мы также создали систему производства CAR T-клеток (ARI-0001) в нашем учреждении (Hospital Clinic de Barcelona). Наша система основана на использовании закрытого полуавтоматического биореактора (CliniMACS Prodigy ® ) для отбора ex vivo , трансдукции и размножения CAR Т-клеток. В настоящее время мы проводим фазу I клинических испытаний с использованием нашего нового анти-CD19 CAR для лечения CD19 + B-клеточных злокачественных новообразований (NCT03144583). В рамках этого клинического испытания мы успешно подготовили 28 клеточных продуктов ARI-0001.Здесь мы представляем результаты и характеристики полученных продуктов, тем самым впервые демонстрируя возможность продукции CAR Т-клеток у относительно широкой группы пациентов, прошедших интенсивное предварительное лечение, с использованием системы CliniMACS Prodigy.

Материалы и методы

Пациенты и образцы

На момент подачи этой рукописи было произведено 28 продуктов от 27 пациентов, включенных в фазу I клинического исследования CD19 + B-клеточных злокачественных новообразований (NCT03144583).Среди 27 пациентов 22 имели ОЛЛ (14 взрослых и 8 детей), 4 — НХЛ и 1 — ХЛЛ. У всех пациентов, включенных в клиническое испытание, возник рецидив болезни. Предварительные режимы лечения пациентов приведены в таблице 1.

Таблица 1 . Режимы подготовки пациентов к лечению.

Взрослые пациенты были подвергнуты лейкоцитаферезу в отделении афереза ​​клиники больницы и педиатрическим пациентам в отделении афереза ​​больницы Сан-Хуан-де-Деу / BST после подписания информированного согласия.Процедуры афереза ​​выполнялись с использованием устройства Amicus (Fresenius Kabi, Lake Zurich, IL). Требовалось минимум 1 × 10 8 ​​ общих Т-клеток, разведенных в 50 мл плазмы. Это исследование было одобрено Комитетом по этике исследований (CeIm) больничной клиники. HCB / 2017/0001. Клиническое испытание: CART19-BE-01. Eudra: 2016-002972-29.

ARI-0001 Производство клеток

продуктов афереза ​​были подключены к набору трубок системы CliniMACS Prodigy ® (Miltenyi Biotec). Эритроциты и тромбоциты удаляли центрифугированием в градиенте плотности в приборе Centricult.Остальные клетки были отобраны с использованием магнитных шариков, покрытых CD4 и CD8. Отобранные клетки элюировали в «мешке для повторного нанесения». После отбора 1 × 10 8 ​​ Т-клеток (из мешка для повторного нанесения) использовали для инициации культивирования клеток. Оставшиеся клетки криоконсервировали в мешках и флаконах для использования в качестве контрольных клеток для анализа качества продукции и в качестве резервной копии в случае сбоя производства. Клетки культивировали с использованием среды TexMACS ® с добавлением 3% сыворотки АВ человека (полученной из банка крови.BST) и 155 МЕ / мл IL-7 и 290 МЕ / мл IL-15 (Miltenyi Biotec # 170-076-111 и # 170-076-114 соответственно). Клетки немедленно активировали с использованием TransACT GMP Grade (Miltenyi Biotec, Cat. No. 170-076-156) и трансдуцировали через 24 часа с использованием CAR19-содержащего лентивируса при MOI = 10. Промывание клеточной культуры было запрограммировано через 48 часов после трансдукции. Затем клетки поддерживали в культуре при увеличивающемся встряхивании до тех пор, пока не было достигнуто желаемое количество клеток (обычно через 7-10 дней после начала культивирования клеток).Наконец, клетки элюировали 100 мл 0,9% NaCl + 1% HSA, разделяли на аликвоты в соответствии с желаемой дозой клеток ARI-0001 и замораживали до инфузии.

Целью было получение двух доз клеток ARI-0001 на пациента. Планируемая доза клеток-мишеней варьировалась в зависимости от заболевания пациента. Обычно 1 × 10 6 клеток ARI-0001 / кг для пациентов с ОЛЛ и ХЛЛ и 5 × 10 6 клеток ARI-0001 / кг для пациентов с НХЛ.

Моноклональные антитела

Экспрессия

CAR19 была обнаружена с помощью APC-конъюгированного AffiniPureF (ab ‘) 2 -фрагмента козьего антимышиного IgG (Jackson ImmunoResearch Laboratories, 115-136-072).Состав клеточного продукта ARI-0001 определяли методом проточной цитометрии с использованием окрашивания следующими антителами (все от BD): CD45-APC, CD3-BV421, CD4-FITC, CD8-PerCPCy5.5, CD19-PECy7, CD16-PE, CD56. -ПЭ.

Для экспериментов по характеристике подмножества Т-клеток клетки CAR + детектировали с использованием химеры рекомбинантного белка CD19-Fc (R&D, кат. № 9269-CD-050) и вторичного антитела FITC-Goat F (ab) 2 анти- человеческий IgG (Life Technologies, Cat. N. h20101C). Это окрашивание сочетали со следующими моноклональными антителами (все от BD): CD3-BV421, CD8-APC.Cy7, CD45RA-PECy7, CD45RO-APC, CCR7-PerCPCy5.5, CD28-BV510 и CD95-PE (или CD27-PE). Субпопуляции Т-клеток были определены следующим образом: T N : CD45RA +, CCR7 +; Т SCM : CD45RA +, CCR7 +, CD95 +; T CM : CD45RA–, CCR7 +; T EM : CD45RA-, CCR7- и T EFF : CD45RA +, CCR7-.

Для измерения внутриклеточных цитокинов использовали следующие антитела, все от BD: CD3-BV450, CD8-APC.H7, CD4-BV500, IFNγ-PerCP.Cy5.5, TNFα-PE.

Для эксперимента с повторным заражением использовали следующие антитела, все от BD: CD3-APC, CD4-BV510, CD8-APC.Cy7, CD19-PE.

Для анализа проточной цитометрии клетки собирали с помощью FACS Canto II, BD, а затем анализировали с помощью программного обеспечения FlowJo.

Контроль качества продукции

Анализ активности продукта проводили методом проточной цитометрии, как описано в Castella et al. (37). ПЦР в реальном времени использовали для измерения количества копий на клетку и для оценки присутствия репликационно-компетентного лентивируса (RCL) в конечном продукте. Последовательности праймеров и протокол ПЦР были описаны ранее (37).Стерильность продукта, отсутствие микоплазмы, эндотоксина и побочного вируса определялась сертифицированной лабораторией с использованием методики, указанной в таблице S1. Посторонний вирус включал определение наличия вируса ВИЧ среди прочего. Поскольку обычные методы обнаружения ВИЧ выявляют также присутствие трансгена лентивируса, используемого для трансдукции клеток, был использован альтернативный анализ ПЦР, основанный на обнаружении гена Env, для различения ВИЧ-инфекции и трансдукции лентивируса. Праймеры, используемые для амплификации гена Env, следующие: Env_F: 5’CAATGTACACATGGAATTAGGCCA 3 ‘и Env_R: 5’ TTCTGGGTCCCCTCCTGAGGA 3 ‘.

Измерение цитокинов

Уровень цитокинов

измеряли с использованием панелей Milliplex MAP Human Cytokine / Chemokine Magnetic Bead (Millipore). Набор из 10-сплетений для IFNγ, IL-10, IL-1β, IL-6, TNFα, IL-12 (P40), IL-17, IL-2, IL-4 и IP-10, 3-сплетения Использовали набор для IL-8, IL-15 и MIP1A (Cat N. HCYTOMAG-60K) и набор 1-plex для GranzymeB (Cat. N. HCD8MAG-15K). Анализ проводили в соответствии с инструкциями производителя. Образцы обрабатывали в системе Luminex 200.

Альтернативно, продукцию внутриклеточных цитокинов (IFNγ и TNFα) измеряли с помощью проточной цитометрии.Вкратце, клетки сначала метили на внеклеточные маркеры CD4, CD8 и CD3 и инкубировали 15 мин. Затем клетки фиксировали с использованием 1X лизирующего раствора BD (кат. № 349202) и инкубировали в течение дополнительных 15 мин. После 2 промывок клетки подвергали проницаемости с использованием буфера FACS + 0,1% сапонина и инкубировали в течение 15 мин. Затем клетки инкубировали с анти-IFNγ и анти-TNFα в течение 30 минут при 4 ° C. После этого клетки промывали PBS и анализировали.

Мелкомасштабные экспансии Т-клеток

0,5 × 10 6 Т-клеток культивировали с клеточной средой X-Vivo 15 (Cultek, Cat.N. BE02-060Q), 5% AB человеческой сыворотки (Sigma, Cat. N. h5522), пенициллин-стрептомицин (100 мкг / мл) и указанный цитокин: 50 МЕ / мл IL-2 (Miltenyi Biotec) или 155 МЕ / мл IL-7 и 290 МЕ / мл IL-15 (Miltenyi Biotec). Цитокины добавляли в среду каждые 48 часов. Через двадцать семь часов после оттаивания клетки активировали с помощью Dynabeads Human T-Activator CD3 / CD28 (Gibco, кат. № 11131D) в соответствии с инструкциями производителя. Клетки трансдуцировали еще через 24 часа с MOI 10, а затем размножали в течение 11 дней до концентрации 0.5 × 10 6 до 1,5 × 10 6 Т-клеток / мл.

Экспансия Т-клеток после повторных провокаций клетками-мишенями

Для анализа способности к пролиферации Т-клеток после встречи с антигеном мы засевали совместную культуру клеток CAR-T и клеток NALM6 в соотношении 1: 1 (по 250 000 клеток каждая). После 4 дней инкубации отбирали аликвоту культуры и анализировали для определения количества Т-клеток. Клетки метили CD3, CD4, CD8 и CD19, а затем 20 мкл гранул (CountBright, Cat.N. C36950, Invitrogen) добавляли к образцу для определения абсолютного числа клеток. Этот процесс повторялся 3 раза.

Статистика

Статистическая значимость оценивалась с помощью программного обеспечения SPSS. Если не указано иное, использовали непарный T-тест. U-Mann Whitney использовался для сравнения переменных с ненормальными распределениями. Статистическую значимость считали, когда значение p ≤ 0,05.

Результаты

CAR T-Cell Expansion

Двадцать восемь продуктов афереза ​​были получены от 27 пациентов, включенных в клиническое исследование.Для одного пациента продукт афереза ​​был получен дважды из-за неспособности продуцировать клетки ARI-0001 (продукты T10 и T13 принадлежат одному пациенту). Описание продуктов для афереза ​​представлено в таблице 2. Продукты для афереза ​​пациентов подвергались CD4 + и CD8 + магнитной селекции с использованием системы CliniMACS Prodigy. Во всех случаях, кроме одного (Пациент Т27), было получено минимальное количество Т-клеток (100 × 10 6 ) (Таблица 2). У пациента T27 культивирование клеток было инициировано с использованием 50 × 10 6 клеток.

Таблица 2 . Состав продуктов афереза ​​и отбор клеток CD4-CD8.

Результаты размножения клеток в CliniMACS Prodigy для 27 продуктов представлены на рисунках 1A, B и в таблице S2. Клетки увеличивались в среднем в течение 8,5 дней, диапазон 7–10. Среднее общее количество ячеек, полученное в конечном продукте, составило 2,548 × 10 6 , диапазон от 600 × 10 6 до 5200 × 10 6 . У одного пациента, у которого культивирование клеток было начато с 50 × 10 6 клеток, конечный продукт также соответствовал критериям приемлемости.В этом конкретном случае культуру клеток поддерживали в течение 13 дней, в итоге получив 3300 × 10 6 клеток. По сравнению со здоровыми донорами (использованными в трех предыдущих прогонах проверки) клетки пациента, кажется, расширяются медленнее, даже если количество прогонов, выполняемых со здоровыми донорами, ограничено (рис. 1C).

Рисунок 1 . Расширение ARI-0001-клеток в CliniMACS Prodigy. (A) Кинетика расширения продуктов ARI-0001-клеток (общее количество клеток). Серые точки обозначают отдельные продукты.Черные треугольники обозначают среднее значение ± стандартное отклонение и регулировочную кривую. (B) Кинетика разрастания клеток CAR19 + (красный) и общее количество клеток (черный). Представлено среднее ± стандартное отклонение. (C) Кинетика разрастания клеток ARI-0001 (общее количество клеток) при сравнении здоровых контролей и различных типов заболеваний. Представлено среднее ± SEM. (D) Процент CD3- и CAR19-положительных клеток, определенный с помощью проточной цитометрии. Также указано среднее ± стандартное отклонение. Панели справа показывают репрезентативное изображение проточной цитометрии, соответствующее окрашиванию CAR19 и CD3 в конечных продуктах клеток ARI-0001 и контрольных Т-клетках (нетрансдуцированных).

Продукты были проанализированы с точки зрения внешнего вида, количества, идентичности, чистоты, безопасности и активности. Полный список технических характеристик продукта представлен в Таблице S1.

Чистота продукта и эффективность преобразования

Конечный продукт характеризовали с точки зрения жизнеспособности клеток, процента клеток CD3 + и процента клеток CAR +. Эти данные сведены в Таблицу 3. Все продукты соответствовали критериям приемлемости для жизнеспособности клеток и процентного содержания клеток CD3 + (> 70% для обоих параметров).Наименьшее значение жизнеспособности клеток было 91 и 85,7% для клеток CD3 + (рис. 1D).

Таблица 3 . Характеристика продукта ARI-0001.

Чтобы проанализировать процент CAR + клеток, мы сначала проверили наш метод обнаружения, основанный на использовании APC-конъюгированного антитела против F (ab ‘) 2 против мыши. С этой целью мы сконструировали вектор, в котором коэкспрессируются CAR19 и GFP. Как показано на рисунке S2, корреляция между клетками GFP + APC + или GFP – APC– составляет 93.5%, что свидетельствует о хорошей чувствительности и специфичности метода обнаружения.

Используя эту систему обнаружения, мы оценили процент клеток CAR + (ARI-0001) в продуктах пациентов. Все продукты, кроме одного, соответствовали спецификации ячеек ARI-0001> 20%. В одном продукте (Т10) было обнаружено только 14,5% клеток ARI-0001. Следовательно, этот продукт был признан производственным браком. Продукция CAR Т-клеток была повторена для этого пациента после 2-го афереза ​​(T13). На этот раз можно было получить действующий продукт.Среднее (± стандартное отклонение) процентного содержания CAR + клеток в этой серии составило 30,6 ± 13,44 (рисунки 1B – D), что немного ниже, чем эффективность трансдукции, достигнутая при небольших разложениях (45,3%) (рисунок S1A). Никаких существенных различий в эффективности трансдукции не наблюдалось между здоровыми донорами и пациентами (35,8 против 30,6%) или среди различных заболеваний (Рисунок S1B). Также исследовали процентное содержание CAR + клеток с течением времени во время размножения клеток. Среди пациентов была обнаружена высокая степень вариабельности: у одних пациентов процент клеток CAR + увеличивался, а у других снижался (рисунок S3).Что касается количества клеточных доз, полученных на одного пациента, с учетом стандартного веса 70 кг для взрослых и 25 кг для педиатрических пациентов, минимум две дозы клеток были быстро получены (к 7-му дню) для всех пациентов (доза 1 × 10). 6 ARI-0001 клеток / кг). Для пациентов с НХЛ (доза 5 × 10 6 ARI-0001 клеток / кг) две клеточные дозы были получены для трех из четырех пациентов к 9-му дню. Действительно, количество клеточных доз, полученных для ОЛЛ, намного превышало потребность ( девять клеточных доз для взрослых пациентов и 25.4 для педиатрических пациентов), что указывает на то, что время экспансии клеток ex vivo может быть сокращено при необходимости в этих группах пациентов. Для НХЛ среднее количество полученных доз клеток ARI-0001 составило 2,5. На данный момент произведен только один пациент с ХЛЛ. Т-клетки этого пациента росли медленнее и требовали 10 дней размножения, в конечном итоге получив 398 × 10 6 клеток ARI-0001.

Трансдукция

CAR19 также оценивалась по количеству копий ДНК на клетку. Как показано в таблице 3, CAR19 был обнаружен во всех продуктах в диапазоне от 0.4–2,9 копий на ячейку (все ниже допустимого предела <10 копий на ячейку). Как и ожидалось, была получена положительная корреляция между процентом клеток CAR + и копиями ДНК / клетка, что дополнительно подтвердило оба метода (рисунок S4).

Эффективность продукта

Цитотоксический потенциал был проанализирован in vitro, для каждого продукта перед инфузией. Совместное культивирование конечного продукта с клеточной линией NALM6 было инициировано при различных соотношениях E: T. Процент живых CD19 + клеток измеряли с помощью проточной цитометрии через 4 часа.В качестве контроля также измеряли цитотоксическую активность нетрансдуцированных клеток CD4 + CD8 + от того же пациента. Продукты считались действительными, когда доля выживших клеток CD19 + с клетками ARI-0001 при соотношении 1: 1 была ниже 70%. Результаты представлены в таблице 3 и на рисунке 2A. Все полученные продукты соответствовали спецификации выжившей фракции CD19 + <70% при соотношении Е: Т 1: 1, что указывает на то, что все полученные продукты обладают внутренней способностью элиминировать клетки CD19 +.

Рисунок 2 .Активность клеток ARI-0001. (A) Анализ цитотоксичности после 4 часов совместного культивирования ARI-0001 с клетками NALM6 в указанных соотношениях. Показано среднее значение ± стандартное отклонение для всех 27 продуктов CAR Т-клеток. (#) Пунктирная линия указывает минимальный уровень цитотоксичности для клеток ARI-0001 для продукта, который считается действительным. (B) Уровни IFNγ, TNFα и GranzymeB, измеренные в супернатантах анализов цитотоксичности. Отношение E: T 0 указывает на отсутствие клеток-мишеней. (*) обозначает статистическую значимость, p <0.05. (C) Сравнение цитотоксического потенциала ARI-0001 после 4 часов совместного культивирования с клетками NALM6 при указанных соотношениях. Показано среднее ± стандартное отклонение. «Н.с.» указывает на отсутствие статистической значимости (непараметрический тест). (D) Сравнение уровней IFNγ, TNFα и GranzymeB, измеренных в супернатантах анализа цитотоксичности при соотношении E: T 1: 1. «HD» указывает на здоровых доноров. «Н.с.» указывает на отсутствие статистической значимости (параметрический тест, применяемый к IFNγ и TNFα, и непараметрический тест, применяемый к GranzymeB).

Уровень цитокинов также измеряли в надосадочной жидкости при анализах цитотоксичности. Как и ожидалось, при совместном культивировании клеток ARI-0001 с NALM6 наблюдались повышенные уровни провоспалительных цитокинов, таких как IFNγ и TNFα, по сравнению с одними клетками ARI-0001. Уровень GranzymeB также был значительно увеличен (рис. 2B), что соответствует цитотоксической активности клеток ARI-0001. Полный набор проанализированных цитокинов представлен на Рисунке S5.

CAR Т-клеток, полученных от пациентов, сравнивали с таковыми, полученными от здоровых контролей, с точки зрения цитотоксической активности и продукции цитокинов.Как показано на рисунке 2C, CAR Т-клетки пациентов и здоровых доноров показали сходный цитотоксический потенциал (даже немного выше для клеток пациента, хотя это не было статистически значимым). Производство провоспалительных цитокинов (IFNγ и TNFα) и GranzymeB также было сопоставимым (рис. 2D).

Характеристика подмножества Т-клеток

Состав продукта был дополнительно проанализирован с точки зрения соотношения CD4 / CD8 и подмножеств T N , T SCM , T CM , T E и T EM .В соответствии с предыдущими сообщениями (38) соотношение CD4 / CD8 было инвертировано (соотношение CD4 / CD8 <1) у большой подгруппы пациентов, которые были кандидатами на терапию CAR Т-клетками (рис. 3A). Среднее соотношение CD4 / CD8 в продуктах афереза ​​составляло 0,93 ± 0,67. Это соотношение существенно не изменилось после отбора клеток CD4 и CD8 у подавляющего большинства пациентов. Однако во время размножения клеток было обнаружено значительное увеличение доли клеток CD4. Соотношение CD4 / CD8 увеличилось с 0,64 ± 0,61 после отбора клеток CD4-CD8 до 1.61 ± 1,04 в конечном продукте. Более глубокий анализ этих данных показал, что у пациентов, начиная с отношения CD4 / CD8 <1, доля CD4 + клеток имела тенденцию к увеличению во время размножения клеток, в то время как у пациентов, у которых соотношение CD4 / CD8> 1 было получено после отбора клеток, доля клеток CD4 + имела тенденцию к снижению (рис. 3В). Следовательно, разница в соотношении CD4 / CD8 (ΔCD4 / CD8) до и после размножения клеток значительно различалась в зависимости от исходного соотношения (рис. S6A). Эффективность трансдукции различалась между субпопуляциями CD4 + и CD8 +, поскольку CD4 показал значительно более высокий процент клеток CAR + (рис. 3C).

Рисунок 3 . Характеристика подмножества ячеек ARI-0001. (A) Соотношение CD4 / CD8 продуктов афереза ​​после отбора клеток CD4-CD8 и конечного продукта. (B) Изменение соотношения CD4 / CD8 во время размножения клеток. Левая панель соответствует продуктам с начальным соотношением <1. Правая панель соответствует продуктам с начальным соотношением> 1. (C) Эффективность трансдукции CAR19 в клетках CD4 и CD8. Показано среднее ± стандартное отклонение. (D) Процент субпопуляций Т-клеток в начальных (отбор клеток CD4-CD8) и конечных продуктах (клетки CAR– и CAR +). (E) Типичные графики проточной цитометрии трех разных пациентов, показывающие популяции Т-клеток в исходных и конечных продуктах. (F) Различия в MFI для CD45RA и CCR7 в исходных и конечных продуктах. Нижняя панель показывает парный анализ для CCR7 MFI. (*) указывает на статистическую значимость, p <0,05. n.s. указывает на статистически не значимое.

Что касается подмножеств T N , T SCM , T CM , T E и T EM , мы наблюдали высокую степень вариабельности конечных продуктов пациентов (рис. 3D).Эта высокая вариабельность иллюстрируется разным уровнем экспрессии CD45RA и CCR7 в образцах от разных пациентов (рисунки 3E, F) и не может быть отнесена к разным заболеваниям (рисунок S1C). В CAR + T-клетках конечного продукта фенотипы памяти (CM и EM) преобладали у подавляющего большинства пациентов. Средний процент и стандартное отклонение для каждой субпопуляции в клетках CAR + конечного продукта следующие: T N : 7,71 ± 13,9, T SCM : 5,26 ± 12,0, T CM : 31.01 ± 16,7, T EM : 35,11 ± 17,7 и T E : 4,2 ± 9,5. Анализ клеток CD4 и CD8 по отдельности показал, что клетки CD8 имеют больший фенотип T N , T SCM и T CM , чем клетки CD4 (фигура S6B). Мы также проанализировали, как эти подмножества менялись во время экспансии клеток ex vivo , сравнивая подмножества Т-клеток в исходном (после отбора клеток CD4-CD8) и в конечном продукте, и влияла ли экспрессия CAR на субпопуляции Т-клеток (CAR– vs .CAR + клетки). Как показано на рисунке 3D, мы наблюдали устойчивое увеличение доли T CM во время размножения клеток, в то время как T N и T EFF клеток уменьшались. Эти изменения в подмножествах Т-клеток можно отнести к снижению экспрессии CD45RA, которое ожидается после активации клеток (Фигуры 3E, F).

Не было обнаружено статистически значимых изменений в подмножествах Т-клеток между CAR– и CAR + клетками в конечном продукте, хотя дальнейшее увеличение T CM и последующее снижение T EFF клеток наблюдалось в сравниваемых CAR + клетках. в АВТОМОБИЛЬ– (Рис. 3D).Соответственно, небольшое увеличение экспрессии CCR7 также было обнаружено в клетках CAR + по сравнению с клетками CAR-. (Рисунок 3F). Влияние экспрессии CAR на CCR7 было дополнительно исследовано в независимых небольших расширениях (см. Следующий раздел). Изменения экспрессии CD27, CD28 и CD95 также оценивали с помощью проточной цитометрии. Как показано на рисунке S6C, CD95 увеличивался во время размножения клеток, а CD27 снижался. CD28 не обнаруживал значительных изменений во время размножения, хотя проявлял более высокую экспрессию в CAR + по сравнению с CAR- клетками.

Мелкомасштабные экспансии CAR Т-клеток

Для дополнительной оценки влияния условий культивирования или экспрессии CAR на соотношение CD4 / CD8 или Т-клеточный фенотип, разрастания клеток из выбранных пациентов пациентов повторяли в небольшом эксперименте при различных условиях. Мы выбрали шесть пациентов (три взрослых с ОЛЛ и три НХЛ), у которых были доступны замороженные клетки, оставшиеся после отбора клеток CD4-CD8. Мы увеличили клетки пациентов в четырех различных условиях: (1a) IL2 — нетрансдуцированные Т-клетки, (1b) IL2 — CAR Т-клетки, (2a) IL7 / IL15 — нетрансдуцированные T-клетки, (2b) IL7 / IL15 — CAR Т-клетки.Как показано на рисунке S7A, клетки увеличивались от 17 до 100 раз за период 11 дней. Трансдуцированные CAR19 Т-клетки увеличивались меньше (или медленно) по сравнению с нетрансдуцированными аналогами, а клетки, выросшие на IL2, увеличивались больше, чем IL7 / IL15 (как в нетрансдуцированных, так и в условиях CAR19) (фигура S7B). Трансдукция клеток или использованные цитокины не определяли постоянным образом соотношение CD4 / CD8. Однако, как было обнаружено ранее в продуктах, расширенных с использованием системы Prodigy, у пациентов, начинающих с соотношением CD4 / CD8> 1 (T04 и T34), это соотношение имело тенденцию к снижению, в то время как у пациентов, начинающих с соотношением CD4 / CD8 <1 (T02, T15, T22 и T34) соотношение имело тенденцию к увеличению (рисунок S7C).Действительно, поскольку расширения поддерживались дольше в мелкомасштабных расширениях, чем в системе Prodigy, мы наблюдали, что соотношение CD4 / CD8 может колебаться более или менее явно, но оно имеет тенденцию к CD4 / CD8 = 1, если клетки культивируются в течение более длительных периодов времени.

Интересно, что значительные различия были обнаружены в отношении субпопуляций Т-клеток в зависимости от условий культивирования. Цитокины, используемые в питательной среде, не показали значительных различий в отношении различных подгрупп в этой серии пациентов.Однако значительная и стойкая разница была оценена в клетках, экспрессирующих CAR19, по сравнению с нетрансдуцированными Т-клетками почти для всех подмножеств. Как показано на фигуре S7D, трансдукция CAR19 приводила к гораздо более высокому процентному содержанию субпопуляций T N , T SCM и T CM независимо от цитокина, используемого в культуральной среде. Напротив, количество клеток T EM было снижено в клетках CAR19 + по сравнению с нетрансдуцированными образцами. В этом случае не наблюдалось различий в MFI CD45RA между нетрансдуцированными клетками и клетками CAR19 +, что может объяснить снижение T , N и T SCM , поскольку в обоих условиях клетки были активированы и пролиферировали ex vivo .Однако мы наблюдали значительное увеличение экспрессии CCR7 в клетках CAR19 + по сравнению с нетрансдуцированными клетками (рисунок S7E). Это увеличение объясняет более высокий процент подмножеств T N , T SCM и T CM и более низкий T EM . Повышение экспрессии CCR7 при активации 4-1BB было ранее описано для моноцитов (39), а также предложено для CAR Т-клеток (40). Чтобы проверить, отвечает ли активация 4-1BB за увеличение CCR7, которое мы наблюдаем в клетках CAR +, мы модифицировали нашу конструкцию CAR, изменив костимулирующий домен на CD28 (рисунок S8A).Затем Т-клетки здорового донора оставляли нетрансдуцированными или трансдуцированными 4-1BB- или CD28-содержащими CAR и размножали in vitro в течение 10 дней. Опять же, мы наблюдали увеличение экспрессии CCR7 в CAR-положительной фракции клеток, трансдуцированных конструкцией, содержащей 4-1BB, по сравнению с нетрансдуцированными клетками или CD28-содержащими CAR + клетками (фигура S8B). Как и ожидалось, процент клеток T CM также выше в 4-1BB-содержащих CAR + клетках (рисунок S8C).

Наконец, была также сравнена функциональность CAR Т-клеток, произведенных с помощью системы Prodigy и небольших расширений.Для этого сравнения использовали клетки от 3 пациентов, увеличенные с помощью IL-7 / IL-15. Продукцию провоспалительных цитокинов, цитотоксический потенциал и рост Т-клеток измеряли после корректировки на тот же процент CAR + клеток. Продукцию IFNγ и TNFα измеряли после совместного культивирования CAR Т-клеток с NALM6 в соотношении 1: 1 через 4 часа. Уровень этих двух цитокинов измеряли как по внутриклеточному окрашиванию (фиг. S9A), так и по цитокинам, присутствующим в среде (фиг. S9B), что давало согласованные результаты.Клетки, произведенные в системе Prodigy, постоянно продуцируют немного больше IFNγ и TNFα, чем клетки, произведенные в небольших масштабах. Однако эти различия не были статистически значимыми. Что касается цитотоксического потенциала, клетки, полученные обоими методами, показали сопоставимые результаты (рис. S9C). Наконец, экспансия Т-клеток при повторных заражениях свежими клетками-мишенями (NALM6) была немного выше в клетках, изготовленных с помощью системы Prodigy, чем при мелкомасштабных экспансиях, хотя она не достигла статистической значимости (фигура S9D).Таким образом, мы делаем вывод, что клетки, произведенные с помощью системы Prodigy, функционально сопоставимы или даже немного более активны, чем клетки, произведенные в небольших расширениях.

Взяв все эти данные вместе, мы заключаем, что ex vivo экспансия клеток вызывает потерю T N и T EFF , что наблюдается как в системе Prodigy, так и в мелкомасштабных расширениях. Напротив, клетки T CM в значительной степени накапливаются как в результате экспансии ex vivo , так и в результате экспрессии CAR (в CAR, содержащих 4-1BB в качестве костимулирующего домена).Клетки, произведенные в системе Prodigy, функционально аналогичны тем, которые производятся в небольших расширениях.

Обсуждение

CAR Т-клетки представляют собой сложные медицинские изделия. Большинство подходов, исследованных до сих пор, основаны на использовании аутологичных CAR Т-клеток, что требует производства индивидуального продукта для каждого пациента. Более того, CAR Т-клетки являются продуктами генной терапии, включающими подготовку векторов клинического уровня и последующий отбор, трансдукцию и размножение Т-клеток.Два разных препарата CAR T (Yescarta, Kite-Gilead и Kymriah, Novartis) уже были одобрены для лечения педиатрических ОЛЛ и НХЛ. Тем не менее, разработка новых CAR T-продуктов, включая клинические испытания фазы I и II, для многих различных целей и заболеваний в основном проводится в академических исследовательских центрах. Производство CAR Т-клеток клинического уровня может стать проблемой для многих академических учреждений среднего размера. Ранее мы опубликовали разработку нашего собственного продукта CAR19 (на основе последовательности scFv антитела A3B1) и создание протокола и инфраструктуры производства CAR Т-клеток, основанных на использовании CliniMACS Prodigy, полуавтоматической закрытой системы, разработанной Мильтеньи (37).Мы и другие ранее продемонстрировали возможность производства CAR Т-клеток от здоровых доноров с помощью CliniMACS Prodigy (41–45). Теперь мы сообщаем о приготовлении и характеристике 27 CAR Т-клеточных продуктов для пациентов с ОЛЛ, ХЛЛ или НХЛ.

Пациенты, подходящие для лечения CAR Т-клетками, ранее получали несколько линий терапии. В результате Т-клетки этих пациентов имеют пониженную способность к пролиферации и аномальное соотношение CD4 / CD8 по сравнению со здоровыми донорами (46, 47).Тем не менее, нам удалось получить 27 действительных продуктов CAR Т-клеток (в соответствии со спецификациями, указанными в Таблице S1) из 28 попыток, что доказывает возможность производства CAR Т-клеток для пациентов, прошедших интенсивное предварительное лечение, с использованием системы Prodigy. Размножение клеток сохранялось в среднем 8,5 дней. Действительно, Т-клетки, полученные от пациентов, расширяются медленнее по сравнению с размерами, производимыми от здоровых доноров Т-клеток. Однако для ВСЕХ пациентов, у которых инфузионная доза обычно составляет 1 × 10 6 CAR Т-клеток / кг, минимум 2 дозы CAR Т-клеток уже были достигнуты к 7 дню у 100% пациентов, что указывает на то, что у этой подгруппы пациентов можно сократить время расширения (фактическое время расширения было 8.4 дня, в связи с заранее запланированными планами работ). Пациентам с ХЛЛ и НХЛ требовалось 9–10 дней экспансии из-за снижения собственной пролиферации Т-клеток (48, 49) и более высокого количества необходимых CAR Т-клеток, соответственно. Уменьшение времени размножения Т-клеток весьма желательно не только для снижения стоимости серийного производства и сокращения времени, пока пациент может получить лечение, но также для качества получаемого продукта, как обсуждается ниже. Несмотря на сниженную способность к размножению Т-клеток пациентов, подвергшихся предварительной обработке, по сравнению со здоровыми донорами, мы наблюдали эквивалентную эффективность продукта с точки зрения цитотоксического потенциала и продукции провоспалительных цитокинов.Метод получения CAR Т-клеток (Prodigy по сравнению с мелкомасштабным) дал также сопоставимые продукты с точки зрения эффективности продукта или даже немного более активные в клетках, полученных с помощью Prodigy. Мы рассудили, что более высокая плотность клеток, достигаемая в системе Prodigy, может быть полезна для приспособления и активности Т-клеток.

Средняя эффективность трансдукции составила в среднем 30,6% в нашей серии и существенно не различается между пациентами и здоровыми людьми из контрольной группы. Об аналогичной эффективности трансдукции сообщали другие группы, использующие CliniMACS Prodigy для производства CAR Т-клеток от здоровых контролей (41, 50–52), за исключением одного исследования, в котором сообщается об эффективности трансдукции между 50–60% при очень высоком MOI (MOI = 100). ) (44).Эффективность трансдукции в мелкомасштабном производстве клеток CAR-T немного выше (45,3 против 30,6%). Мы можем предположить, что возможность прямого контакта клеток и лентивируса, то есть спинокуляция, или добавление в среду реагентов, которые облегчают проникновение лентивируса в клетки (например, полибрен), может помочь повысить эффективность трансдукции в системе Prodigy. .

Мы наблюдали предпочтение размножения CD4 + клеток перед CD8 + ex vivo . Это согласуется с предыдущими наблюдениями других групп, использующих различные системы расширения и конструкции CAR (53, 54).Gomes-Silva и соавторы сообщили о преимущественном увеличении количества клеток CD4 при использовании костимулирующего домена 4-1BB по сравнению с CD28-содержащим CAR (55). Следовательно, этот эффект может частично объяснить это явление. Действительно, мы обнаружили более высокую фракцию трансдуцированных CD4 клеток, чем CD8. Тем не менее, мы ясно показали, что отношения CD4 / CD8 сильно зависят от исходного соотношения и имеют тенденцию к равновесию при более длительных экспансиях ex vivo , что указывает на то, что предпочтительное увеличение CD4 может быть временным и колебаться также после инфузии CAR Т-клеток.

Фенотипы T N , T SCM и T CM были связаны с более длительным сохранением in vivo и более высокой противоопухолевой эффективностью (38, 56–58). Мы проанализировали факторы, определяющие эти популяции Т-клеток, с целью анализа возможности оптимизации нашей производственной системы. Действительно, существует очень высокая степень вариабельности фенотипов Т-клеток среди пациентов, что в значительной степени определяет состав конечного продукта. В наших экспериментальных условиях как IL-7 / IL-15, так и IL-2 давали сопоставимые популяционные фенотипы.У большинства пациентов культура клеток ex vivo приводила к снижению доли CD45RA-положительных клеток в конечном продукте. Потеря экспрессии CD45RA ожидается при активации и пролиферации клеток и, следовательно, присуща разрастанию клеток ex vivo , что приводит к уменьшению количества клеток T N (38, 40, 59, 60). В связи с этим сокращение времени экспансии клеток ex vivo , когда это возможно, может помочь сохранить эту популяцию. Также было показано, что клетки T CM способны создавать стойкую Т-клеточную память (58) и обладают превосходным противоопухолевым действием (38).Следовательно, потеря клеток T N может не иметь большого влияния на противоопухолевую эффективность, поскольку большинство из них превращается в клетки T CM . Фактически, фенотипы памяти — это наиболее представленные популяции в наших конечных продуктах CAR T, что согласуется с предыдущими отчетами (53). Было показано, что 4-1BB-содержащие CAR Т-клетки имеют повышенную долю T CM по сравнению с CD28-содержащими CAR, которые имеют преобладающую популяцию T EM (40, 55). Мы показали, что увеличение T в клетках CM является не только результатом потери CD45RA, но также из-за повышенной экспрессии CCR7 в 4-1BB-содержащих CAR-экспрессирующих клетках [наши данные и Kawalekar et al.(40)]. Эти данные коррелируют с более длительной персистенцией CAR Т-клеток in vivo 4-1BB- по сравнению с CD28-содержащими CAR (11, 12, 49).

В заключение, мы впервые продемонстрировали возможность производства CAR Т-клеток для пациентов с тяжелым предварительным лечением ОЛЛ, ХЛЛ и НХЛ с использованием CliniMACS Prodigy. Насколько нам известно, это первый отчет, в котором описаны характеристики продуктов, полученных с помощью этой системы, в том числе для средней и большой когорты пациентов. Наше исследование показывает, что производство CAR Т-клеток может быть завершено всего за 7 дней для ВСЕХ пациентов и что уменьшенное время экспансии ex vivo может давать продукты CAR T-клеток с повышенной персистентностью in vivo .Полученные продукты демонстрируют сильную противоопухолевую эффективность и характеризуются преобладанием фенотипов T CM и T EM .

Заявление о доступности данных

Все наборы данных, созданные для этого исследования, включены в статью / дополнительные материалы.

Заявление об этике

Это исследование было одобрено Комитетом по этике исследований (CeIm) больничной клиники. HCB / 2017/0001. Клиническое испытание: CART19-BE-01. Eudra: 2016-002972-29. Письменное информированное согласие на участие в этом исследовании было предоставлено законным опекуном / ближайшими родственниками участников.

Взносы авторов

MC разработал и провел эксперименты, проанализировал данные и написал рукопись. MC-B и VO-M координировали определенные части клинического испытания и анализировали данные. EG-N, GS, AA-V, AB, BM и LM проводили эксперименты и процедуры. Контролируемые процедуры BM-A, JCi, ML, EG, JT, ET, UP, JCa, TB и DB-R. ЭК критически прочитал рукопись. ÁU-I, JY SR, JD и MJ координировали и контролировали исследование.

Финансирование

Эта работа в основном финансировалась несколькими государственными грантами PI13 / 00676, PIE13 / 00033, PI17 / 01043, PICIS14 / 00122 и PI18 / 00775; включены в Национальный план I + D + I и софинансируются ISCIII — Subdirección General de Evaluación y Fomento de la Investigación Sanitaria — и Европейским фондом дезарролло (FEDER), а также программой краудфандинга Projecte ARI.

Конфликт интересов

SR декларирует расходы на бюро докладчиков и командировочные расходы: Novartis, Shire, JazzPharma, Erytech.

Остальные авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы хотели бы поблагодарить пациентов и семьи, которые участвовали в этом испытании, а также тех, кто сделал это возможным. Авторы также хотят поблагодарить Сару Вареа, ответственную за контроль качества этого клинического исследования.Carolina España, Juan Ramon Ortega, Carla Guijarro и Libertad Heredia за их техническую поддержку в производстве CAR Т-клеток. Наконец, авторы благодарят Кристину Льянос, медсестру-исследовательницу педиатрических пациентов больницы Сан-Хуан-де-Деу. Наконец, мы также хотим поблагодарить за поддержку многих людей и организаций, которые поддержали и помогли нам разработать это предложение в Барселоне.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fimmu.2020.00482/full#supplementary-material

Список литературы

7. Кочендерфер Дж. Н., Уилсон В. Х., Яник Дж. Э., Дадли М. Е., Стетлер-Стивенсон М., Фельдман С. А. и др. Искоренение клеток B-линии и регресс лимфомы у пациента, получавшего аутологичные Т-клетки, генетически сконструированные для распознавания CD19. Кровь. (2010) 116: 4099–102. DOI: 10.1182 / кровь-2010-04-281931

PubMed Аннотация | CrossRef Полный текст | Google Scholar

8.Портер Д.Л., Левин Б.Л., Калос М., Багг А., июнь СН. Модифицированные химерными антигенными рецепторами Т-клетки при хроническом лимфолейкозе. N Engl J Med. (2011) 365: 725–33. DOI: 10.1056 / NEJMoa1103849

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Ван Х, Попплуэлл Л.Л., Вагнер Дж. Р., Наранхо А., Бланшар М.С., Мотт М.Р. и др. Фаза 1 исследований терапии Т-клетками CD19 CAR, полученными из центральной памяти, после аутологичной ТГСК у пациентов с В-клеточной НХЛ. Кровь. (2016) 127: 2980–90.DOI: 10.1182 / кровь-2015-12-686725

PubMed Аннотация | CrossRef Полный текст | Google Scholar

10. Maude SL, Frey N, Shaw PA, Aplenc R, Barrett DM, Bunin NJ, et al. Т-клетки химерного антигенного рецептора для устойчивой ремиссии при лейкемии. N Engl J Med. (2014) 371: 1507–17. DOI: 10.1056 / NEJMoa1407222

PubMed Аннотация | CrossRef Полный текст | Google Scholar

11. Ли Д. У., Кочендерфер Дж. Н., Стетлер-Стивенсон М., Цуй Ю. К., Делбрук С., Фельдман С. А. и др.Т-клетки, экспрессирующие рецепторы химерного антигена CD19, при остром лимфобластном лейкозе у детей и молодых людей: испытание фазы 1 с увеличением дозы. Ланцет. (2015) 385: 517–28. DOI: 10.1016 / S0140-6736 (14) 61403-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

12. Brentjens RJ, Riviere I, Park JH, Davila ML, Wang X, Stefanski J, et al. Безопасность и стойкость адоптивно перенесенных аутологичных CD19-нацеленных Т-клеток у пациентов с рецидивирующими или резистентными к химиотерапии В-клеточными лейкозами. Кровь. (2011) 118: 4817–28. DOI: 10.1182 / кровь-2011-04-348540

PubMed Аннотация | CrossRef Полный текст | Google Scholar

13. Кочендерфер Дж. Н., Дадли М. Е., Карпентер Р. О., Кассим С. Х., Роуз Дж. Дж., Телфорд В. Г. и др. Донорские CD19-нацеленные Т-клетки вызывают регресс злокачественных новообразований, сохраняющихся после трансплантации аллогенных гемопоэтических стволовых клеток. Кровь. (2013) 122: 4129–39. DOI: 10.1182 / кровь-2013-08-519413

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14.Кочендерфер Дж. Н., Дадли М. Е., Кассим С. Х., Сомервилл РПТ, Карпентер Р. О., Стетлер-Стивенсон М. и др. Рефрактерная к химиотерапии диффузная крупноклеточная В-клеточная лимфома и вялотекущие В-клеточные злокачественные новообразования можно эффективно лечить аутологичными Т-клетками, экспрессирующими рецептор химерного антигена к CD19. J Clin Oncol. (2015) 33: 540–9. DOI: 10.1200 / JCO.2014.56.2025

PubMed Аннотация | CrossRef Полный текст | Google Scholar

15. Брудно Дж. Н., Марич И., Хартман С. Д., Роуз Дж. Дж., Ван М., Лам Н. и др.Т-клетки, генетически модифицированные для экспрессии рецептора химерного антигена антигена созревания В-клеток, вызывают ремиссии рецидивирующей множественной миеломы с плохим прогнозом. J Clin Oncol. (2018) 36: 2267–80. DOI: 10.1200 / JCO.2018.77.8084

PubMed Аннотация | CrossRef Полный текст | Google Scholar

16. Али С.А., Ши В., Марич И., Ван М., Стрончек Д.Ф., Роуз Дж. Дж. И др. Т-клетки, экспрессирующие рецептор химерного антигена антигена созревания В-клеток, вызывают ремиссии множественной миеломы. Кровь. (2016) 128: 1688–700. DOI: 10.1182 / кровь-2016-04-711903

PubMed Аннотация | CrossRef Полный текст | Google Scholar

17. Чжао В.Х., Лю Дж., Ван Би-И, Чен И-Икс, Цао Х-М, Ян И и др. Фаза 1, открытое исследование LCAR-B38M, Т-клеточной терапии химерного антигенного рецептора, направленной против антигена созревания В-клеток, у пациентов с рецидивирующей или рефрактерной множественной миеломой. J Hematol Oncol. (2018) 11: 141. DOI: 10.1186 / s13045-018-0681-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

18.Рамос К.А., Баллард Б., Чжан Х., Дахова О., Джи А.П., Мэй З. и др. Клинические и иммунологические ответы на лимфоциты, перенаправленные на CD30-специфический химерный антиген-рецептор. J Clin Invest. (2017) 127: 3462–71. DOI: 10.1172 / JCI94306

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19. Ван С-М, Ву З-К, Ван И, Го И-Л, Дай Х-Р, Ван Х-Х и др. Аутологичные Т-клетки, экспрессирующие рецепторы химерного антигена CD30, для рецидивирующей или рефрактерной лимфомы Ходжкина: открытое испытание фазы I. Clin Cancer Res. (2017) 23: 1156–66. DOI: 10.1158 / 1078-0432.CCR-16-1365

PubMed Аннотация | CrossRef Полный текст | Google Scholar

20. Фрай Т.Дж., Шах Н.Н., Орентас Р.Дж., Стетлер-Стивенсон М., Юань С.М., Рамакришна С. и др. CAR Т-клетки, нацеленные на CD22, вызывают ремиссию B-ALL, которая является наивной или устойчивой к иммунотерапии CAR, нацеленной на CD19. Nat Med. (2017) 24: 20–8. DOI: 10,1038 / нм.4441

PubMed Аннотация | CrossRef Полный текст | Google Scholar

21.Кершоу М.Х., Вествуд Д.А., Паркер Л.Л., Ван Г., Эшхар З., Маврукакис С.А. и др. Фаза I исследования адоптивной иммунотерапии с использованием генно-модифицированных Т-клеток для лечения рака яичников. Clin Cancer Res. (2006) 12: 6106–15. DOI: 10.1158 / 1078-0432.CCR-06-1183

PubMed Аннотация | CrossRef Полный текст | Google Scholar

22. О’Рурк Д.М., Насралла М.П., ​​Десаи А., Меленхорст Дж. Дж., Мэнсфилд К., Морриссетт Дж. Дж. Д. и др. Однократная доза периферически введенных EGFRvIII-направленных CAR Т-клеток опосредует потерю антигена и индуцирует адаптивную резистентность у пациентов с рецидивирующей глиобластомой. Sci Transl Med. (2017) 9: eaaa0984. DOI: 10.1126 / scitranslmed.aaa0984

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Кац С.К., Бурга Р.А., Маккормак Э., Ван Л.Дж., Швартовка В., Пойнт Г.Р. и др. Фаза I печеночной иммунотерапии для изучения метастазов внутриартериальной терапии Т-клетками, модифицированной химерным антигеном, для лечения метастазов в печени CEA +. Clin Cancer Res. (2015) 21: 3149–59. DOI: 10.1158 / 1078-0432.CCR-14-1421

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24.Битти Г.Л., О’Хара М.Х., Лейси С.Ф., Ториджан Д.А., Назимуддин Ф., Чен Ф. и др. Активность Т-клеток мезотелин-специфического химерного антигенного рецептора против метастазов карциномы поджелудочной железы в испытании фазы 1. Гастроэнтерология. (2018) 155: 29–32. DOI: 10.1053 / j.gastro.2018.03.029

PubMed Аннотация | CrossRef Полный текст | Google Scholar

25. Ахмед Н., Броули В.С., Хегде М., Робертсон К., Гази А., Геркен С. и др. Т-клетки, модифицированные рецептором химерного антигена, специфичные к рецептору 2 эпидермального фактора роста человека (HER2) (HER2), для иммунотерапии HER2-положительной саркомы. J Clin Oncol. (2015) 33: 1688–96. DOI: 10.1200 / JCO.2014.58.0225

PubMed Аннотация | CrossRef Полный текст | Google Scholar

26. Thistlethwaite FC, Gilham DE, Guest RD, Rothwell DG, Pillai M, Burt DJ и др. Клиническая эффективность CAR Т-клеток, специфичных для карциноэмбрионального антигена первого поколения (CEACAM5), ограничена плохой персистентностью и временной респираторной токсичностью, зависящей от прекондиционирования. Cancer Immunol Immunother. (2017) 66: 1425–36. DOI: 10.1007 / s00262-017-2034-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

27. Морган Р.А., Ян Дж.С., Китано М., Дадли М.Э., Лоренкот К.М., Розенберг С.А. Отчет о случае серьезного нежелательного явления после введения Т-клеток, трансдуцированных химерным антигенным рецептором, распознающим ERBB2. Mol Ther. (2010) 18: 843–51. DOI: 10.1038 / mt.2010.24

PubMed Аннотация | CrossRef Полный текст | Google Scholar

28. Ламерс С.Х., Слейфер С., ван Стинберген С., ван Эльзаккер П., ван Кримпен Б., Грут С. и др.Лечение метастатической почечно-клеточной карциномы с помощью Т-клеток, созданных CAIX CAR: клиническая оценка и управление токсичностью в отношении мишени. Mol Ther. (2013) 21: 904–12. DOI: 10.1038 / mt.2013.17

PubMed Аннотация | CrossRef Полный текст | Google Scholar

29. Lamers CHJ, Sleijfer S, Vulto AG, Kruit WHJ, Kliffen M, Debets R, et al. Лечение метастатической почечно-клеточной карциномы аутологичными Т-лимфоцитами, генетически перенаправленными против карбоангидразы IX: первый клинический опыт. J Clin Oncol. (2006) 24: e20–2. DOI: 10.1200 / JCO.2006.05.9964

PubMed Аннотация | CrossRef Полный текст | Google Scholar

30. Браун С.Э., Ализаде Д., Старр Р., Венг Л., Вагнер Дж. Р., Наранхо А. и др. Регресс глиобластомы после терапии химерными антигенными рецепторами Т-клетками. N Engl J Med. (2016) 375: 2561–9. DOI: 10.1056 / NEJMoa1610497

PubMed Аннотация | CrossRef Полный текст | Google Scholar

31. Knochelmann HM, Smith AS, Dwyer CJ, Wyatt MM, Mehrotra S, Paulos CM.CAR-Т-клетки в солидных опухолях: планы создания эффективных методов лечения. Front Immunol. (2018) 9: 1740. DOI: 10.3389 / fimmu.2018.01740

PubMed Аннотация | CrossRef Полный текст | Google Scholar

32. Лонг К.Б., Янг Р.М., Бостяну А.С., Дэвис М.М., Меленхорст Дж. Дж., Лейси С.Ф. и др. CAR Т-клеточная терапия негематопоэтических злокачественных новообразований: обходные пути на пути к клиническому успеху. Front Immunol. (2018) 9: 2740. DOI: 10.3389 / fimmu.2018.02740

PubMed Аннотация | CrossRef Полный текст | Google Scholar

33.Хойос В., Савольдо Б., Квинтарелли С., Махендравада А., Чжан М., Вера Дж. И др. Конструирование CD19-специфических Т-лимфоцитов с интерлейкином-15 и суицидным геном для усиления их противолимфомных / лейкозных эффектов и безопасности. Лейкемия. (2010) 24: 1160–70. DOI: 10.1038 / leu.2010.75

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34. Chmielewski M, Abken H. CAR Т-клетки, выделяющие IL-18, конвертируются в эффекторы T-Bethigh FoxO1low, которые проявляют повышенную активность против распространенных солидных опухолей. Cell Rep. (2017) 21: 3205–19. DOI: 10.1016 / j.celrep.2017.11.063

PubMed Аннотация | CrossRef Полный текст | Google Scholar

35. Krenciute G, Prinzing BL, Yi Z, Wu M-F, Liu H, Dotti G, et al. Gottschalk S. Трансгенная экспрессия IL15 улучшает антиглиомную активность IL13Rα2-CAR Т-клеток, но приводит к вариантам потери антигена. Cancer Immunol Res. (2017) 5: 571–81. DOI: 10.1158 / 2326-6066.CIR-16-0376

PubMed Аннотация | CrossRef Полный текст | Google Scholar

36.Chmielewski M, Abken H. CAR T-клетки трансформируются в грузовики: Т-клетки, перенаправляемые на химерный антиген, рецептор, сконструированные для доставки индуцибельного IL-12, модулирующие строму опухоли для борьбы с раком. Cancer Immunol Immunother. (2012) 61: 1269–77. DOI: 10.1007 / s00262-012-1202-z

PubMed Аннотация | CrossRef Полный текст | Google Scholar

37. Кастелла М., Боронат А., Мартин-Ибаньес Р., Родригес В., Сунье Дж., Кабальеро М. и др. Разработка нового рецептора химерного антигена против CD19: парадигма доступного производства CAR Т-клеток в академических учреждениях. Mol Ther Methods Clin Dev. (2019) 12: 134–44. DOI: 10.1016 / j.omtm.2018.11.010

PubMed Аннотация | CrossRef Полный текст | Google Scholar

38. Соммермейер Д., Худечек М., Косасих П.Л., Гогишвили Т., Малони Д.Г., Черепаха С.Дж. и др. Модифицированные химерным антигенным рецептором Т-клетки, полученные из определенных субпопуляций CD8 + и CD4 +, придают превосходную противоопухолевую реактивность in vivo . Лейкемия. (2016) 30: 492–500. DOI: 10.1038 / leu.2015.247

PubMed Аннотация | CrossRef Полный текст | Google Scholar

40.Кавалекар О.Ю., О’Коннор Р.С., Фрайетта Д.А., Гуо Л., МакГеттиган С.Е., Поузи А.Д. и др. Четкая передача сигналов корецепторов регулирует специфические пути метаболизма и влияет на развитие памяти в CAR Т-клетках. Иммунитет. (2016) 44: 380–90. DOI: 10.1016 / j.immuni.2016.01.021

PubMed Аннотация | CrossRef Полный текст | Google Scholar

41. Александрова К., Лейзе Дж., Приснер С., Мелк А., Кубаинк Ф., Абкен Х. и др. Функциональность и клеточное старение CD4 / CD8-выбранных CD20 CAR Т-клеток, полученных с использованием автоматизированной платформы CliniMACS Prodigy®. Гемотерапия Transfus Med. (2019) 46: 47–54. DOI: 10.1159 / 000495772

PubMed Аннотация | CrossRef Полный текст | Google Scholar

42. Марин Моралес Дж. М., Мюнч Н., Петер К., Фройнд Д., Эльшлегель Ю., Хелиг К. и др. Автоматизированное расширение регуляторных Т-клеток клинической степени в полностью закрытой системе. Front Immunol. (2019) 10:38. DOI: 10.3389 / fimmu.2019.00038

PubMed Аннотация | CrossRef Полный текст | Google Scholar

44. Zhang W, Jordan KR, Schulte B, Purev E.Характеристика Т-лимфоцитов рецептора химерного антигена CD19 клинической степени, полученных с использованием автоматизированной системы CliniMACS prodigy. Drug Des Devel Ther. (2018) 12: 3343–56. DOI: 10.2147 / DDDT.S175113

PubMed Аннотация | CrossRef Полный текст | Google Scholar

45. Priesner C, Александрова K, Esser R, Mockel-Tenbrinck N, Leise J, Drechsel K, et al. Автоматизированное обогащение, трансдукция и распространение CD62L + Т-клеток клинического масштаба для производства лекарственных препаратов для генной терапии. Hum Gene Ther. (2016) 27: 860–9. DOI: 10.1089 / hum.2016.091

PubMed Аннотация | CrossRef Полный текст | Google Scholar

46. Mackall CL, Fleisher TA, Brown MR, Andrich MP, Chen CC, Feuerstein IM, et al. Различия между путями регенерации CD8 + и CD4 + Т-клеток приводят к длительному дисбалансу субпопуляции Т-клеток после интенсивной химиотерапии. Кровь. (1997) 89: 3700–7. DOI: 10.1182 / blood.V89.10.3700.3700_3700_3707

PubMed Аннотация | CrossRef Полный текст | Google Scholar

47.Макколл С., Флейшер Т., Браун М., Маграт I, Шад А., Горовиц М. и др. Истощение лимфоцитов во время интенсивной химиотерапии рака. Кровь. (1994) 84: 2221–8. DOI: 10.1182 / blood.V84.7.2221.2221

PubMed Аннотация | CrossRef Полный текст | Google Scholar

48. Fraietta JA, Beckwith KA, Patel PR, Ruella M, Zheng Z, Barrett DM, et al. Ибрутиниб усиливает приживление Т-клеток химерного антигенного рецептора и повышает эффективность при лейкемии. Кровь. (2016) 127: 1117–27.DOI: 10.1182 / кровь-2015-11-679134

PubMed Аннотация | CrossRef Полный текст | Google Scholar

49. Портер Д.Л., Хван В.Т., Фрей Н.В., Лейси С.Ф., Шоу П.А., Лорен А.В. и др. Химерные антигенные рецепторные Т-клетки сохраняются и вызывают стойкие ремиссии при рецидивирующей рефрактерной хронической лимфоцитарной лейкемии. Sci Transl Med. (2015) 7: 303ra139. DOI: 10.1126 / scitranslmed.aac5415

PubMed Аннотация | CrossRef Полный текст | Google Scholar

50. Чжу Ф., Шах Н.Н., Сюй Х., Шнайдер Д., Орентас Р., Дропулич Б. и др.Производство CAR-T-клеток с использованием системы Clinimacs® Prodigy. Кровь. (2016) 128: 5724. DOI: 10.1182 / blood.V128.22.5724.5724

CrossRef Полный текст | Google Scholar

51. Mock U, Nickolay L, Philip B, Cheung GWK, Zhan H, Johnston ICD и др. Автоматизированное производство Т-клеток химерного антигенного рецептора для адоптивной иммунотерапии с использованием CliniMACS prodigy. Цитотерапия. (2016) 18: 1002–11. DOI: 10.1016 / j.jcyt.2016.05.009

PubMed Аннотация | CrossRef Полный текст | Google Scholar

52.Blaeschke F, Stenger D, Kaeuferle T, Willier S, Lotfi R, Kaiser AD, et al. Индукция центральной памяти и фенотипа памяти стволовых клеток в функционально активных CD4 + и CD8 + CAR Т-клетках, полученных в автоматизированной системе надлежащей производственной практики для лечения CD19 + острого лимфобластного лейкоза. Cancer Immunol Immunother. (2018) 67: 1053–66. DOI: 10.1007 / s00262-018-2155-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

53. Blaeschke F, Kaeuferle T, Feucht J, Weber D, Lotfi R, Kaiser A, et al.Определен фенотип Т-клеток центральной памяти и стволовой памяти для Т-лимфоцитов CD4 и CD8 для лечения острого лимфобластного лейкоза CD19 + в автоматизированной закрытой системе. Кровь. (2016) 128: 1053–66. DOI: 10.1182 / blood.V128.22.4558.4558

CrossRef Полный текст | Google Scholar

54. Холлиман Д., Стефански Дж., Пшибиловски М., Бартидо С., Боркес-Охеда О., Тейлор С. и др. Проверка производства биологически функциональных Т-клеток, нацеленных на антиген CD19, для терапии аутологичных адоптивных клеток. J Immunother. (2009) 32: 169–80. DOI: 10.1097 / CJI.0b013e318194a6e8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

55. Гомес-Силва Д., Мукерджи М., Сринивасан М., Кренчиуте Г., Дахова О., Чжэн Ю. и др. Костимуляция тоником 4-1BB в рецепторах химерных антигенов препятствует выживанию Т-клеток и является вектор-зависимой. Cell Rep. (2017) 21: 17–26. DOI: 10.1016 / j.celrep.2017.09.015

PubMed Аннотация | CrossRef Полный текст | Google Scholar

57.Hinrichs CS, Borman ZA, Gattinoni L, Yu Z, Burns WR, Huang J, et al. Человеческие эффекторные CD8 + Т-клетки, полученные из наивных, а не из подгруппы памяти, обладают превосходными характеристиками для адоптивной иммунотерапии. Кровь. (2011) 117: 808–14. DOI: 10.1182 / кровь-2010-05-286286

PubMed Аннотация | CrossRef Полный текст | Google Scholar

58. Бергер К., Дженсен М.К., Лансдорп П.М., Гоф М., Эллиотт С., Ридделл С.Р. Адоптивный перенос эффекторных CD8 + Т-клеток, происходящих из центральных клеток памяти, устанавливает стойкую Т-клеточную память у приматов. J Clin Invest. (2008) 118: 294–305. DOI: 10.1172 / JCI32103

PubMed Аннотация | CrossRef Полный текст | Google Scholar

59. Ларби А., Фулоп Т. От «действительно наивных» до «истощенных стареющих» Т-клеток: когда маркеры предсказывают функциональность. Cytom Часть A. (2014) 85: 25–35. DOI: 10.1002 / cyto.a.22351

CrossRef Полный текст | Google Scholar

60. Leitenberg D, Novak TJ, Farber D, Smith BR, Bottomly K. Внеклеточный домен CD45 контролирует ассоциацию с рецепторным комплексом CD4-Т-клеток и ответ на антиген-специфическую стимуляцию. J Exp Med. (1996) 183: 249–59. DOI: 10.1084 / jem.183.1.249

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Amazon.com: Kum AS2, Автоматическая точилка для карандашей с длинным острием на два отверстия, Mfg Part Number 1053021 (Дополнительные крышки в комплект не входят): Office Products

5,0 из 5 звезд Отличный момент.
Кристина Мартин, 25 сентября, 2017

Зачем нужна точилка с длинным концом? Одна из причин заключается в том, что требуется немного больше времени, чтобы затупиться, и лучше использовать свинец.Более того, у вас больше контроля над своими штрихами. Вы можете делать большие участки сбоку поводка, сохранив кончик для тех мест, где вам нужна резкая линия. Если у вас есть высококачественные карандаши, это может быть хорошей экономией. Вы хотите, чтобы карандаши прослужили как можно дольше.

У этой точилки прекрасный длинный наконечник, а лезвия острые и точные. Эта точилка для карандашей немного отличается от тех, что вы помните из школы. В нем есть два отверстия, но они не для карандашей двух разных размеров.Скорее, первое отверстие предназначено для придания формы дереву, а второе — для формирования грифеля. Это то, что позволяет ему получить такую ​​длинную точку.

Точилки для карандашей Kum уже имеют прочную репутацию благодаря прочным и острым титановым лезвиям. У меня уже был один, который мне очень понравился, но в нем не было улавливателя стружки, поэтому я подумал, что буду модернизировать, особенно когда я увидел эту длинную точилку. Я не был разочарован. Я был немного смущен, потому что точилка прибыла в коробке, которая, по-видимому, является той же коробкой, что и почти идентичная точилка, которая также поставляется с указателем карандаша сбоку для 2-миллиметровых проводов держателя грифеля.Коробка указала на это, но это было не так. (Нет проблем, я не заказывал один с указателем, поэтому у меня не было причин его ожидать.)

Единственное, что нужно знать, это то, что он не может творить чудеса с карандашом, у которого нет ведущий прямо посередине. Некоторые из моих Prismacolors имеют неравномерное нанесение свинца, и было невозможно получить их с помощью этой точилки. Но на самом деле виноват карандаш, а не точилка. Карандаш, заполненный неравномерно, всегда будет трудно точить.(Derwent Colorsoft и Faber Castell Polychromos — цветные карандаши аналогичного качества, но более центрированные.) Я включил фотографии карандашей, заточенных с помощью этой точилки, вместе с некоторыми, которые еще не были заточены.

Автоматическое обнаружение точек интереса для открытых онлайн-образовательных видеолекций

  • 1.

    Alharbi G, Hain T (2015) Использование моделей сегментации тем для автоматической организации ресурсов moocs. В: EDM, стр. 524–527

  • 2.

    Энтони Л. (2014) Antconc (версия 3.4.3)

  • 3.

    Бисвас А., Ганди А., Дешмук О. (2015) Mmtoc: Мультимодальный метод для создания таблиц содержания в образовательных видео. В: Материалы 23-й международной конференции ACM по мультимедиа, стр. 621–630. ACM

  • 4.

    Blei DM, Ng AY, Jordan MI (2003) Скрытое распределение дирихле. J Mach Learn Res 3: 993–1022

    MATH Google ученый

  • 5.

    Cha M, Kwak H, Rodriguez P, Ahn YY, Moon S (2007) Я трубка, трубка, все трубки: анализ крупнейшей в мире видеосистемы, генерируемой пользователями.В: Материалы 7-й конференции ACM SIGCOMM по измерению Интернета, стр. 1–14. ACM

  • 6.

    Chorianopoulos K (2013) Коллективный разум в веб-видео. Human-Centric Comput Inf Sci 3 (1): 10

    Статья Google ученый

  • 7.

    Deldjoo Y, Elahi M, Cremonesi P, Garzotto F, Piazzolla P, Quadrana M (2016) Система рекомендаций видео на основе контента, основанная на стилистических визуальных особенностях. J Data Semant 5 (2): 99–113

    Статья Google ученый

  • 8.

    Габриелатос К., Марчи А. (2012) Ключевые слова: соответствующие показатели и практические вопросы. В: Международная конференция CADS. Доступно по адресу http://repository.edgehill.ac.uk/4196/1/Gabrielatos (по состоянию на 10 ноября 2017 г.)

  • 9.

    Гелбух А., Сидоров Г., Лавин-Вилла Е, Чанона-Эрнандес Л. (2010) Автомат извлечение терминов с использованием сравнения на основе логарифма правдоподобия с общим справочным корпусом. В: Международная конференция по применению естественного языка в информационных системах, стр. 248–255.Springer

  • 10.

    Giannakopoulos T, Makris A, Kosmopoulos D, Perantonis S, Theodoridis S (2010) Аудиовизуальный синтез для обнаружения сцен насилия в видео. В: Греческая конференция по искусственному интеллекту, стр. 91–100. Springer

  • 11.

    Хофманн М., Клинкенберг Р. (2013) RapidMiner: сценарии использования интеллектуального анализа данных и приложения бизнес-аналитики. CRC Press

  • 12.

    Hoic-Bozic N, Dlab MH, Mornar V (2016) Система рекомендаций и инструменты Web 2.0 для улучшения модели смешанного обучения.IEEE Trans Educ 59 (1): 39–44

    Статья Google ученый

  • 13.

    Имран Х., Белгис-Заде М., Чанг Т.В., Граф С. и др. (2016) Plors: персонализированная система рекомендаций по объектам обучения. Vietnam J Comput Sci 3 (1): 3–13

    Статья Google ученый

  • 14.

    Ji X, Liu H (2010) Достижения в области инвариантного анализа движений человека: обзор. IEEE Trans Syst Man Cybern Part C Appl Rev 40 (1): 13–24

    Google ученый

  • 15.

    Лю Б., Лю Л., Цыкин А., Гудолл Г.Дж., Грин Дж. Э., Чжу М., Ким Ч.Х., Ли Дж. (2010) Идентификация функциональных регуляторных модулей миРНК – мРНК с соответствующим латентным распределением дирихле. Биоинформатика 26 (24): 3105–3111

    Статья Google ученый

  • 16.

    Мансуризаде М., Чаркари Н.М. (2010) Приложение слияния мультимодальной информации для распознавания человеческих эмоций по лицу и речи. Multimed Tools Appl 49 (2): 277–297

    Артикул Google ученый

  • 17.

    МакКаллум А.К. (2002) Маллет: машинное обучение для языкового инструментария

  • 18.

    Парк Д., Раманан Д., Фаулкс С. (2010) Модели с несколькими разрешениями для обнаружения объектов. В: Европейская конференция по компьютерному зрению, стр. 241–254. Springer

  • 19.

    Pazienza MT, Pennacchiotti M, Zanzotto FM (2005) Извлечение терминологии: анализ лингвистических и статистических подходов. В: Извлечение знаний, стр 255–279. Springer

  • 20.

    Филбин Дж., Сивик Дж., Зиссерман А. (2011) Геометрическое латентное распределение дирихле на графе сопоставления для крупномасштабных наборов данных изображений.Int J Comput Vis 95 (2): 138–153

    MathSciNet Статья Google ученый

  • 21.

    Pojanapunya P, Todd RW (2016) Логарифмическое правдоподобие и отношение шансов: статистика ключевости для различных целей анализа ключевых слов. Корпусная лингвистика и лингвистическая теория

  • 22.

    Райсон П., Гарсайд Р. (2000) Сравнение корпусов с использованием частотного профилирования. В: Материалы семинара по сравнению корпусов, стр. 1–6. Ассоциация компьютерной лингвистики

  • 23.

    Розен-Цви М., Гриффитс Т., Стейверс М., Смит П. (2004) Модель автор-тема для авторов и документов. В: Материалы 20-й конференции по неопределенности в искусственном интеллекте, стр. 487–494. AUAI Press

  • 24.

    Rousseau A, Deléglise P, Esteve Y (2012) Ted-lium: специальный корпус для автоматического распознавания речи. In: LREC, pp 125–129

  • 25.

    Wei X, Croft WB (2006) Модели документов на основе Lda для специального поиска. В: Материалы 29-й ежегодной международной конференции ACM SIGIR по исследованиям и разработкам в области поиска информации, стр. 178–185.ACM

  • 26.

    Willett P (2006) Алгоритм остановки портера: тогда и сейчас. Программа 40 (3): 219–223

    Статья Google ученый

  • 27.

    Zhang H, Sun M, Wang X, Song Z, Tang J, Sun J (2017) Smart jump: автоматическое предложение навигации для видео в муках. В: Материалы 26-й международной конференции по всемирной паутине, стр. 331–339. Руководящий комитет международных всемирных веб-конференций

  • 28.

    Zhou X, Chen L, Zhang Y, Qin D, Cao L, Huang G, Wang C (2017) Улучшение рекомендаций по онлайн-видео с помощью взаимодействия с пользователем в социальных сетях. Журнал VLDB, стр. 1–20

  • Автоматическая заточка с удлиненным концом KUM AS2

    Знаменитый автомат KUM Automatic затачивает карандаши до очень длинного острия в два этапа. Одно отверстие используется для придания формы дереву, второе — для грифеля. Автоматический тормоз предотвращает переточку. Флип-кейс имеет небольшой контейнер для отходов и два запасных лезвия.Подходит для всех карандашей круглой, шестиугольной и треугольной формы.

    Лезвия из углеродистой стали

    KUM имеют высочайшее качество.

    Дополнительная информация
    Код товара: KM08489
    Цвет товара: Красный
    Компания

    Kum, базирующаяся в Эрлангене, Германия, производит одни из лучших точилок для карандашей в мире с 1919 года. Они производят широкий выбор различных точилок, от простейших блочных точилок из латуни или магниевых сплавов до замечательной автоматической точилки Long Point. точилка, которая затачивает дерево и ведет за несколько этапов, чтобы получить длинное узкое острие.

    Все они оснащены лезвиями из высококачественной высокоуглеродистой стали KUM, которые слегка изогнуты, поэтому действуют как пружина, поддерживая постоянное давление на винт и надежно удерживая лезвие на месте.

    Они также делают выдающиеся кисти, на их фабрике остается единственный действующий производитель кистей Golden Master в мире, что требует 45-летнего опыта изготовления кистей!

    Заказы, размещенные до полудня с понедельника по пятницу, обычно отправляются в тот же день.

    Заказы в Великобритании

    БЕСПЛАТНО Доставка Королевской почтой первого класса для заказов на сумму более 25 фунтов стерлингов и всего 2,95 фунтов стерлингов для небольших заказов. Специальная доставка Royal Mail доступна за дополнительную плату в размере 6,95 фунтов стерлингов или БЕСПЛАТНО для любого заказа на сумму более 100 фунтов стерлингов, но обратите внимание, что коронавирус означает, что обычная гарантия не применяется — извините. Никаких дополнительных сборов за доставку в Северную Ирландию, Хайленд и острова или где-либо еще!

    Международный

    Международные доставки различаются по стоимости, поэтому вам нужно добавить товары, которые вы хотите, в корзину, и перейти на кассу, чтобы увидеть варианты доставки.Цены и способы оплаты будут соответствовать вашей стране, и во многих странах включены все налоги и сборы, чтобы упростить и сделать работу более предсказуемой.

    Заказы свыше 2 кг

    Для всех заказов за пределами Великобритании отправка тяжелых заказов может стоить дороже, но стоимость доставки будет отображаться при оформлении заказа до их подтверждения.

    Дополнительная информация

    Подробнее см. На странице Информация о доставке .

    Автоматическая маркировка облаков точек для создания сетевых входных данных в BEV и…

    Контекст 1

    … больших аннотированных данных облака точек создает проблему при обучении и оценке сети. Применять краудсорсинговую ручную маркировку данных сложно из-за огромного количества точек в каждом отдельном облаке сцены. Вдохновленные [10], [11], мы вместо этого предлагаем процесс автоматической маркировки, показанный на рис. 1, чтобы автоматически маркировать точку 3D LiDAR …

    Context 2

    … image. Обратите внимание, что в случае наличия аннотаций объекта ограничивающего прямоугольника, как в тесте обнаружения объектов KITTI [9], мы непосредственно помечаем эти точки внутри трехмерного ограничивающего прямоугольника как сегменты транспортного средства.Наконец, с помощью калибровки камеры-LiDAR сегменты дороги и транспортных средств переносятся из пространства изображений в облако точек, как показано на рис. 1. …

    Context 3

    … Bird-Eye -Просмотр (BEV): изначально мы определяем интересующую область в необработанном облаке точек, охватывая большую площадь перед автомобилем длиной 50 м (x ∈ [0, 50]) и шириной 18 м (y ∈ [−6 , 12]) (см. Темно-серые точки на рис. 1). Все трехмерные точки в этой интересующей области затем проецируются и распределяются на двухмерную сеточную карту размером 256 × 64.Карта сетки соответствует плоскости x — y LiDAR и формирует BEV, то есть проекцию облака точек сверху. Мы устанавливаем размеры ячейки сетки равными 0,2 и 0,3 по осям x− и y соответственно. Пример BEV …

    Контекст 4

    … затем трехмерные точки в этой интересующей области проецируются и распределяются на двухмерную сеточную карту размером 256 × 64. Карта сетки соответствует плоскости x — y LiDAR и формирует BEV, то есть проекцию облака точек сверху.Мы устанавливаем размеры ячейки сетки равными 0,2 и 0,3 по осям x− и y соответственно. Пример изображения BEV показан на рис. …

    Контекст 5

    … как интересующая область. В каждой ячейке сетки мы отдельно храним трехмерные декартовы координаты (x, y, z), значение интенсивности (i) и диапазон r = x 2 + y 2 + z 2. Как и в [7], мы также сохраняем двоичную маску, показывающую занятость ячейки сетки. Эти шесть каналов образуют окончательное изображение с разрешением 64 × 512. Пример изображения SFV показан на рис….

    Контекст 6

    … функции в проекции BEV. Когда дело доходит до прогноза SFV, разница между оценками IoU транспортных средств сокращается до 0,6%, хотя SalsaNet по-прежнему работает лучше всех. Это связано с тем, что SFV имеет более компактную форму: небольшие объекты, такие как автомобили, становятся больше, в то время как относительно более крупные объекты (например, фон) занимают меньшую часть изображения SFV (см. Рис. 1). Это открытие указывает на то, что SalsaNet не зависит от проекции, поскольку может фиксировать локальные особенности, т.е.е. одинаково хорошо работает в обеих проекциях …

    Контекст 7

    … больших аннотированных данных облака точек создает проблему при обучении и оценке сети. Применять краудсорсинговую ручную маркировку данных сложно из-за огромного количества точек в каждом отдельном облаке сцены. Вдохновленные [10], [11], мы вместо этого предлагаем процесс автоматической маркировки, показанный на рис. 1, чтобы автоматически маркировать точки 3D LiDAR …

    Context 8

    … изображение. Обратите внимание, что в случае наличия аннотаций объекта ограничивающего прямоугольника, как в тесте обнаружения объектов KITTI [9], мы непосредственно помечаем эти точки внутри трехмерного ограничивающего прямоугольника как сегменты транспортного средства. Наконец, с помощью калибровки камеры-LiDAR сегменты дороги и транспортных средств переносятся из пространства изображений в облако точек, как показано на рис. 1. …

    Контекст 9

    … Bird-Eye -Просмотр (BEV): изначально мы определяем интересующую область в необработанном облаке точек, охватывая большую площадь перед автомобилем длиной 50 м (x ∈ [0, 50]) и шириной 18 м (y ∈ [−6 , 12]) (см. Темно-серые точки на рис.1). Все трехмерные точки в этой интересующей области затем проецируются и распределяются на двухмерную сеточную карту размером 256 × 64. Карта сетки соответствует плоскости x — y LiDAR и формирует BEV, то есть проекцию облака точек сверху. Мы устанавливаем размеры ячейки сетки равными 0,2 и 0,3 по осям x− и y соответственно. Образец BEV …

    Context 10

    … затем трехмерные точки в этой интересующей области проецируются и распределяются на двухмерную сеточную карту размером 256 × 64.Карта сетки соответствует плоскости x — y LiDAR и формирует BEV, то есть проекцию облака точек сверху. Мы устанавливаем размеры ячейки сетки равными 0,2 и 0,3 по осям x− и y соответственно. Образец изображения BEV показан на рис. …

    Контекст 11

    … как интересующая область. В каждой ячейке сетки мы отдельно храним трехмерные декартовы координаты (x, y, z), значение интенсивности (i) и диапазон r = x 2 + y 2 + z 2. Как и в [7], мы также сохраняем двоичную маску, показывающую занятость ячейки сетки.Эти шесть каналов образуют окончательное изображение с разрешением 64 × 512. Образец SFV-изображения показан на рис. …

    Контекст 12

    … особенности в проекции BEV. Когда дело доходит до прогноза SFV, разница между оценками IoU транспортных средств сокращается до 0,6%, хотя SalsaNet по-прежнему работает лучше всех. Это связано с тем, что SFV имеет более компактную форму: небольшие объекты, такие как автомобили, становятся больше, в то время как относительно более крупные объекты (например, фон) занимают меньшую часть изображения SFV (см.рис.1). Этот вывод указывает на то, что SalsaNet не зависит от проекции, поскольку он может фиксировать локальные особенности, то есть одинаково хорошо работает в обеих проекциях .

    Comments

    No comments yet. Why don’t you start the discussion?

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *